Labshake search
Citations for Invivogen :
1 - 50 of 1088 citations for 7 CHLORO 1 METHYL 1H PYRAZOLO 4 3 B PYRIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... or hygromycin B for 7 days (500 µg/ml, InvivoGen). Cells were transfected using GeneJuice (Merck ...
-
bioRxiv - Bioengineering 2022Quote: ... (3) LPS and 150 μg/ml Polymyxin B (Invivogen) for 45 and 90 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... The Class B CpG ODN2006 (ODN 7909, PF_3512676, sequence: 5’-tcgtcgttttgtcgttttgtcgtt-3’, Invivogen) was diluted in sterile endotoxin-free water ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... and hygromycin B (InvivoGen, ant-hg-1). To induce the expression of the integrated genes ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Hygromycin B Gold (InvivoGen, ant-hg-1), GeneticinTM G-418 Sulphate (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
bioRxiv - Microbiology 2022Quote: ... 200 μg/mL Hygromycin-B (Invivogen #ant-hg-1), and 100 μg/mL Zeocin (Invivogen #ant-zn-1).
-
bioRxiv - Neuroscience 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). Neurons infected with GCaMP6f as stated above were infected with AAV9-hSyn-Cre (Addgene #105553-AAV9 ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). For calcium imaging experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100ug/mL Hygromycin B Gold (Invivogen, #ant-hg-1). Blast+/Hygro+ cells were then clonally sorted via FACS as described in the previous section to obtain a uniform population for experiments ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded as 0.3*106 cells in 6-wells plate followed by treatment for 4 h with 333 nM of Torin 1 (InvivoGen) alone or in combination with 200 nM of Bafilomycin A1 for 1 h.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... for AtT20-WT or 80µg mL−1 hygromycin B Gold (Invivogen) for transfected cells.
-
bioRxiv - Immunology 2023Quote: ... or 1 μM 6-formylindolo[3,2-b]carbazole (FICZ [84], Invivogen). Cytokine blockade was achieved using IL-1 receptor A antagonist anakinra (10 μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... and 10 µg/ml Hygromycin B Gold (InvivoGen, #ant-hg-1) was routinely used ...
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B (Invivogen) was added at 20 μg/mL ...
-
bioRxiv - Immunology 2023Quote: ... mice were immunized with 50 μg (day 3 analysis) or 100 μg (day 7 analysis) chicken ovalbumin (OVA) protein (InvivoGen) in PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or hygromycin B Gold (200 µg/ml, InvivoGen, Cat#: ant-hg-1) depending on expressed marker genes ...
-
bioRxiv - Cell Biology 2022Quote: ... Infected cells were selected by incubation in medium containing 200 µg/mL hygromycin B Gold or 3 µg/mL blasticidin S (InvivoGen) for 4 d ...
-
bioRxiv - Cell Biology 2024Quote: ... Infected cells were selected by incubation in medium containing 3 µg/mL blasticidin S or 200 µg/mL hygromycin B Gold (InvivoGen) for 4 d.
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (ant-pm-1, InvivoGen, San Diego, California, USA). Cultures were incubated at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and hygromycin B (InvivoGen) as described previously (35) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and hygromycin B (InvivoGen) at 37ºC and 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... and hygromycin B (InvivoGen).
-
bioRxiv - Genomics 2021Quote: Hygromycin B Gold (100 mg/mL) was ordered from Invivogen (ant-hg-1). Selection was done with 450µg/mL hygromycin.
-
bioRxiv - Cancer Biology 2022Quote: ... in the presence of 650 µg/ml hygromycin B Gold (Invivogen, ant-hg-1). By using limiting dilution assay ...
-
bioRxiv - Microbiology 2020Quote: ... For selection in the presence of resistance markers 50 µg·mL-1 of hygromycin B or 100 µg·mL-1 of pyrithiamine (InvivoGen) were applied ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μg ml-1 puromycin (InvivoGen), and grown at 37 °C in an atmosphere containing 5% CO2 ...
-
bioRxiv - Immunology 2020Quote: ... CpG-B ODN #1826 (Invivogen) was used at 5 μg/ml for stimulation in all experiments.
-
bioRxiv - Molecular Biology 2020Quote: ... Successful integration was monitored by antibiotic selection with hygromycin B (100 µg ml−1, Invivogen) and blasticidin (5 µg ml−1 ...
-
bioRxiv - Immunology 2019Quote: ... Splenic B cells were stimulated with either 1 μg/ml LPS (LPS-EB Ultrapure, InvivoGen), 1 μg/ml LPS + 20 ng/ml IL4 (Recombinant Murine IL-4 ...
-
bioRxiv - Immunology 2019Quote: ... 1 μg/ml synthetic (B) form DNA analog poly(deoxyadenylic-deoxythymidylic) acid (poly(dA:dT)) (Invivogen) or 400 nM dsDNA containing GATC or Gm6ATC sequences ...
-
bioRxiv - Immunology 2022Quote: ... and 250ug/mL Hygromycin B (InVivoGen)) ...
-
bioRxiv - Microbiology 2022Quote: ... five different pseudotypes were generated using expression plasmids of respective spike variants: for prototype B.1/D614G as before (1) or sourced from Invivogen for VOCs Beta (Cat ...
-
bioRxiv - Cancer Biology 2023Quote: ... After 48-72h the medium containing viruses was replaced with fresh media with 1 μg/mL Puromycin or 1 μg/mL Hygromycin B Gold (InvivoGen), used for selection.
-
bioRxiv - Microbiology 2024Quote: For selection in the presence of resistance markers 50 μg ml−1 of hygromycin B or 100 μg ml−1 of pyrithiamine (InvivoGen) were added to the AMM in the growth plates.
-
bioRxiv - Immunology 2022Quote: ... 3′3′-cyclic-di-AMP (3′3′ CDA) (Invivogen, cat. no. tlrl-nacda), 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA ...
-
bioRxiv - Immunology 2022Quote: ... in the presence of 400□μg/mL hygromycin B and 1□mg/mL G418 (both InvivoGen), respectively.
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated B cells were resuspended in B-LCL-medium containing 2.5 μg/ml CpG ODN 2006 (InvivoGen) and 30 μg/ml holo-transferrin (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: 50μg biotinylated NS1 protein or 50μg (4-hydroxy-3-nitrophenyl)-acetyl(15)-OVA (NP-OVA) was adsorbed to 100μg alhydrogel alum (InVivoGen) in a total of 200μL per mouse for 30 min at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... and selected with 4 μg mL−1 puromycin (InvivoGen) for two weeks.
-
bioRxiv - Biophysics 2021Quote: ... and 250 μg/ml Hygromycin B (Invivogen). After 2–3 weeks ...
-
bioRxiv - Immunology 2020Quote: ... B-glucan peptide (BGP) 100ug/mL (Invivogen), high mobility group box 1 (HMGB1 ...
-
bioRxiv - Biochemistry 2022Quote: ... Hygromycin B-Gold (75 μg/mL; Invivogen), blasticidin (10 μg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... and 200 µg/mL Hygromycin B (Invivogen).
-
bioRxiv - Microbiology 2020Quote: ... and 200 µg/mL Hygromycin B (Invivogen) for selection during every second passage ...