Labshake search
Citations for Invivogen :
1 - 50 of 1309 citations for 7 BROMO 1 2 3 4 TETRAHYDROCYCLOPENTA B INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... or hygromycin B for 7 days (500 µg/ml, InvivoGen). Cells were transfected using GeneJuice (Merck ...
-
bioRxiv - Bioengineering 2022Quote: ... (3) LPS and 150 μg/ml Polymyxin B (Invivogen) for 45 and 90 min ...
-
bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
bioRxiv - Immunology 2022Quote: ... 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP) (Invivogen cat. no. tlrl-nacga23), and human IFN-β (PeproTech ...
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA) (Invivogen cat. no. tlrl-nacda2r), 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP ...
-
bioRxiv - Immunology 2023Quote: ... 2′-3′cGAMP was from InvivoGen, human recombinant sTREM2 was from Sino Biological ...
-
bioRxiv - Immunology 2023Quote: ... The Class B CpG ODN2006 (ODN 7909, PF_3512676, sequence: 5’-tcgtcgttttgtcgttttgtcgtt-3’, Invivogen) was diluted in sterile endotoxin-free water ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... and hygromycin B (InvivoGen, ant-hg-1). To induce the expression of the integrated genes ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Hygromycin B Gold (InvivoGen, ant-hg-1), GeneticinTM G-418 Sulphate (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
bioRxiv - Immunology 2021Quote: ... or 2’-3’cGAMP (4µg/ml, Invivogen) for the specified times ...
-
bioRxiv - Immunology 2024Quote: ... or 2µg/mL 2’,3’-cGAMP (InvivoGen), or 2µg/mL poly(I:C ...
-
bioRxiv - Immunology 2020Quote: ... plus the TLR-7 and TLR-8 agonist Resiquimod (R848, 2 µM, InvivoGen), for 24 h ...
-
bioRxiv - Microbiology 2022Quote: ... 200 μg/mL Hygromycin-B (Invivogen #ant-hg-1), and 100 μg/mL Zeocin (Invivogen #ant-zn-1).
-
bioRxiv - Neuroscience 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). Neurons infected with GCaMP6f as stated above were infected with AAV9-hSyn-Cre (Addgene #105553-AAV9 ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). For calcium imaging experiments ...
-
bioRxiv - Immunology 2022Quote: ... immunogen suspensions were gently mixed 1:1 vol/vol with AddaVax adjuvant for immunizations 1 and 2 and O/W for immunization 3 (Invivogen, San Diego, CA) to reach a final concentration of 0.250 mg/mL antigen ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100ug/mL Hygromycin B Gold (Invivogen, #ant-hg-1). Blast+/Hygro+ cells were then clonally sorted via FACS as described in the previous section to obtain a uniform population for experiments ...
-
bioRxiv - Molecular Biology 2022Quote: ... aerogenes suspension (OD600 = 2) in SorMC and the indicated concentration of Hygromycin B Gold (InvivoGen) at 2×105 cells for AX4 or 1×105 cells for NC28.1 ...
-
bioRxiv - Systems Biology 2021Quote: ... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded as 0.3*106 cells in 6-wells plate followed by treatment for 4 h with 333 nM of Torin 1 (InvivoGen) alone or in combination with 200 nM of Bafilomycin A1 for 1 h.
-
bioRxiv - Plant Biology 2021Quote: ... Transgenic Col-0 (LUC) plants were selected on 1/2 MS medium supplemented with 50 μM hygromycin B (InvivoGen, Cat No. ant-hg-5). LUC activity was confirmed as described above ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... for AtT20-WT or 80µg mL−1 hygromycin B Gold (Invivogen) for transfected cells.
-
bioRxiv - Immunology 2023Quote: ... or 1 μM 6-formylindolo[3,2-b]carbazole (FICZ [84], Invivogen). Cytokine blockade was achieved using IL-1 receptor A antagonist anakinra (10 μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... and 10 µg/ml Hygromycin B Gold (InvivoGen, #ant-hg-1) was routinely used ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1), B-27 (ThermoFisher #17504044 ...
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B (Invivogen) was added at 20 μg/mL ...
-
bioRxiv - Immunology 2021Quote: ... 2’-3’-cGAMP and c-di-UMP were purchased from Invivogen. EFV was purchased from Bristol-Myers Squibb.
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... Elution was performed with free 2′3′-cGAMP (100 μM; InvivoGen), 3′3′-cGAMP (100 μM ...
-
bioRxiv - Immunology 2023Quote: ... mice were immunized with 50 μg (day 3 analysis) or 100 μg (day 7 analysis) chicken ovalbumin (OVA) protein (InvivoGen) in PBS ...
-
bioRxiv - Immunology 2023Quote: ... the cells were pre-incubated with the respective antagonist as suggested by the manufacturer’s protocol (STING: H-151 for 1-2 hours and cGAS: RU.521 for 3 hours, both InvivoGen, USA) in cell growth medium ...
-
bioRxiv - Molecular Biology 2021Quote: ... or hygromycin B Gold (200 µg/ml, InvivoGen, Cat#: ant-hg-1) depending on expressed marker genes ...
-
bioRxiv - Cell Biology 2022Quote: ... Infected cells were selected by incubation in medium containing 200 µg/mL hygromycin B Gold or 3 µg/mL blasticidin S (InvivoGen) for 4 d ...
-
bioRxiv - Cell Biology 2024Quote: ... Infected cells were selected by incubation in medium containing 3 µg/mL blasticidin S or 200 µg/mL hygromycin B Gold (InvivoGen) for 4 d.
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (ant-pm-1, InvivoGen, San Diego, California, USA). Cultures were incubated at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Cells were washed and cultured for 5-7 days in the presence of puromycin (2 µg/ml, InvivoGen). Selected cells were expanded ...
-
bioRxiv - Bioengineering 2022Quote: ... 293-cov2-sdf) or 2) Delta/B.1.617.2 variant) (Catalogue code: 293-SARS2-S-V8-dfur) were purchased from Invivogen. The cells were grown in DMEM media containing 10% Fetal Bovine Serum ...
-
bioRxiv - Genomics 2023Quote: ... cells were cultured in the same medium supplemented with 200 μg/ml HygromycinGold B (Invivogen ant-hg-2). To generate cells with constitutive BFP expression ...
-
bioRxiv - Immunology 2020Quote: ... Animals received 1 μg of the TLR-2 ligand Pam3Cys-Ser-(Lys)4 trihydrochloride (Pam3Cys) (Invivogen, San Diego, CA, USA), 1 μg of the TLR-4 ligand LPS (Sigma-Aldrich Corp. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and hygromycin B (InvivoGen) as described previously (35) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and hygromycin B (InvivoGen) at 37ºC and 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... and hygromycin B (InvivoGen).
-
bioRxiv - Genomics 2021Quote: Hygromycin B Gold (100 mg/mL) was ordered from Invivogen (ant-hg-1). Selection was done with 450µg/mL hygromycin.
-
bioRxiv - Genetics 2019Quote: ... For stable sgRNA and shRNA expression 3 days puromycin (2 μg/ml, Invivogen) selection was applied.
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... Infected cells were selected using puromycin for 3 days (2 µg/ml, InvivoGen) or hygromycin B for 7 days (500 µg/ml ...