Labshake search
Citations for Invivogen :
1 - 50 of 555 citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... or 1 μM 6-formylindolo[3,2-b]carbazole (FICZ [84], Invivogen). Cytokine blockade was achieved using IL-1 receptor A antagonist anakinra (10 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... The Class B CpG ODN2006 (ODN 7909, PF_3512676, sequence: 5’-tcgtcgttttgtcgttttgtcgtt-3’, Invivogen) was diluted in sterile endotoxin-free water ...
-
bioRxiv - Immunology 2023Quote: ... we immunized three groups of C57BL/6 mice (n=9) with 5 µg protein antigens adjuvanted with 500 µg alum (Alhydrogel®, Invivogen) and 20 µg CpG (ODN 1826 ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
bioRxiv - Bioengineering 2022Quote: ... (3) LPS and 150 μg/ml Polymyxin B (Invivogen) for 45 and 90 min ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded as 0.3*106 cells in 6-wells plate followed by treatment for 4 h with 333 nM of Torin 1 (InvivoGen) alone or in combination with 200 nM of Bafilomycin A1 for 1 h.
-
Inhaled CpG increases survival and synergizes with checkpoint inhibition in lymphangioleiomyomatosisbioRxiv - Immunology 2023Quote: Mice received CpG class B (5 μg/10 μg) 2x/week (Invivogen, tlrl-1826-5), in 50 μL of PBS ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected with 5 μg/mL hygromycin B Gold (Invivogen). RNAi was induced with 1 μg/mL tetracycline (Sigma).
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg/ml hygromycin B (Calbio-chem. 10 μg/ml blasticidin (InvivoGen). Independent clones were obtained by serial dilution.
-
bioRxiv - Microbiology 2022Quote: ... The parasites were selected with 5 μg/mL hygromycin B Gold (Invivogen). Overexpression was induced with 1 μg/ml tetracycline (Sigma-Aldrich).
-
bioRxiv - Immunology 2022Quote: ... Bay-11 (5µM, InvivoGen) or MG-132 (9.5µM ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Stable transfectants obtained according to the manufacturer’s instructions by homologous recombination at the FRT were selected using 100 μg/mL Hygromycin B Gold (Invivogen, 31282-04-9). HeLa cells were cultured in DMEM supplemented with 10% Fetal Bovine Serum and Penicillin-streptomycin 100units/ml at 37°C with 5% CO2.
-
bioRxiv - Immunology 2021Quote: ... injection of 10 mg/kg poly(I:C) for 6h followed by 2 mg/kg ultrapure LPS-B5 (InvivoGen) prepared from E ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were selected with 100 µg/mL Hygromycin B Gold (Invivogen, #ant-hg-5). Selected clones were isolated and GFP expression was confirmed by Western blotting and flow cytometry.
-
bioRxiv - Systems Biology 2021Quote: ... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... Disease was induced between 6 and 10 weeks of age using 3 mg curdlan (InvivoGen) administered by intraperitoneal injection ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
bioRxiv - Cell Biology 2024Quote: ... Flip-In T-Rex cells were maintained using hygromycin B (30 µg/mL, InvivoGen, ant-hg-5) and blasticidin (30 µg/mL ...
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B (Invivogen) was added at 20 μg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... Infected cells were selected by incubation in medium containing 200 µg/mL hygromycin B Gold or 3 µg/mL blasticidin S (InvivoGen) for 4 d ...
-
bioRxiv - Cell Biology 2024Quote: ... Infected cells were selected by incubation in medium containing 3 µg/mL blasticidin S or 200 µg/mL hygromycin B Gold (InvivoGen) for 4 d.
-
bioRxiv - Cancer Biology 2020Quote: ... Transduced cells were selected for 3 weeks using puromycin (5 μg/mL,-InvivoGen).
-
bioRxiv - Immunology 2020Quote: ... plus 9 μg/mL purified OVA (InvivoGen, USA) in 500 μL supplemented RPMI ...
-
bioRxiv - Immunology 2020Quote: ... plus 9 μg/mL purified OVA (InvivoGen, USA) in 500 μL complete RPMI ...
-
bioRxiv - Molecular Biology 2020Quote: ... and hygromycin B (InvivoGen) as described previously (35) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and hygromycin B (InvivoGen) at 37ºC and 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... and hygromycin B (InvivoGen).
-
bioRxiv - Immunology 2019Quote: ... and stimulated with 1 U/mL of IL-4 (Miltenyi) and 5 ng/mL IL-5 (Miltenyi) supplemented with 1μg/mL LPS (Invivogen) or 10μg/mL CpG ODN (Invivogen ...
-
bioRxiv - Cell Biology 2022Quote: ... and pKANA2CENPB followed by selection on hygromycin B (1 mg/mL, #089-06151, Wako) and blasticidin S (5 µg/mL, #ant-bl-05, InvivoGen).
-
bioRxiv - Cell Biology 2022Quote: ... the cationic lipid-based transfection reagent LyoVec and cyclic [G(2’,5’)pA(3’,5’)p] (2’3’-cGAMP) were obtained from Invivogen (San Diego, USA) and Lipofectamine2000 was obtained from ThermoFisher Scientific (Dreieich ...
-
bioRxiv - Immunology 2020Quote: ... CpG-B ODN #1826 (Invivogen) was used at 5 μg/ml for stimulation in all experiments.
-
bioRxiv - Immunology 2023Quote: ... The Class C CpG ODN_2395 sequence (5’-TCGTCGTTTTCGGCGCGCGCCG-3’) was obtained from Invivogen (#tlrl-2395). We used the crystal structure of mouse TLR9 extracellular domain (TLR9 ECD ...
-
bioRxiv - Bioengineering 2022Quote: ... CD8+ T cells and 5×104 NALM-6 cells were plated with 0.5-1 ng/mL blinatumomab (Invivogen) and cytokine ...
-
bioRxiv - Immunology 2021Quote: ... reagents in human TLR1-9 Agonist kit (InvivoGen, tlrl-kit1hw) were diluted to working concentration in PBS ...
-
bioRxiv - Microbiology 2019Quote: ... Miltenyi, 1000U/mL) and interleukin-4 (IL-4, Miltenyi, 1000U/mL) for 5 days before addition of lipopolysaccharide (LPS, Invivogen, 50 ng/mL) for 2 further days.
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... and 250ug/mL Hygromycin B (InVivoGen)) ...
-
bioRxiv - Immunology 2024Quote: Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... 3′3′-cyclic-di-AMP (3′3′ CDA) (Invivogen, cat. no. tlrl-nacda), 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated B cells were resuspended in B-LCL-medium containing 2.5 μg/ml CpG ODN 2006 (InvivoGen) and 30 μg/ml holo-transferrin (Sigma-Aldrich) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 8 and 9 cell lines were purchased from InvivoGen (Hong Kong). The cells express the human TLR gene and NF-κB/AP-1-inducible SEAP (secreted embryonic alkaline phosphatase ...
-
bioRxiv - Immunology 2021Quote: ... Labeled cells (0.5x106 cells/mL) were cultured for 2-3 days with 5 μg/mL R848 (InvivoGen), 50 U/mL IL-2 (Peprotech) ...
-
bioRxiv - Neuroscience 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). Neurons infected with GCaMP6f as stated above were infected with AAV9-hSyn-Cre (Addgene #105553-AAV9 ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). For calcium imaging experiments ...
-
bioRxiv - Immunology 2022Quote: 50μg biotinylated NS1 protein or 50μg (4-hydroxy-3-nitrophenyl)-acetyl(15)-OVA (NP-OVA) was adsorbed to 100μg alhydrogel alum (InVivoGen) in a total of 200μL per mouse for 30 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... at 37°C and 5% CO2 for 6 h (ex vivo culture) or treated with 20 ng/mL Lipopolysaccharide (LPS) (tlrl-3pelps, Invivogen) for 6 h (LPS stimulation) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Treatment was initiated when tumors reached 5–6 mm in size and was given twice a week: 1 μg MPLA/tumor (#vac-mpls, InvivoGen) and indicated doses of mouse IFNγ (#485-MI/CF ...
-
bioRxiv - Immunology 2022Quote: ... shControl and shLRBA HeLa cells were seeded at 0.3*106 cells in 6 well-plates followed by treatment for 16 h or 24 h with 5 μM of MG132 (InvivoGen) alone or in combination with 100 nM of Bafilomycin A1 for 3 h ...
-
bioRxiv - Immunology 2024Quote: ... C57BL/6 mice were immunized with Spike protein (5 µg, Bio-Techne) in presence of CpG adjuvant (10 µg, ODN1826, Invivogen) according to the immunization protocol in Figure 1 ...