Labshake search
Citations for Invivogen :
1 - 50 of 543 citations for 6 methoxy 2 4 methoxyphenyl benzo b thiophene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... or 1 μM 6-formylindolo[3,2-b]carbazole (FICZ [84], Invivogen). Cytokine blockade was achieved using IL-1 receptor A antagonist anakinra (10 μg/ml ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg/mL) for 6 hr using LyoVecTM (InvivoGen, tlrl-patc) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... aerogenes suspension (OD600 = 2) in SorMC and the indicated concentration of Hygromycin B Gold (InvivoGen) at 2×105 cells for AX4 or 1×105 cells for NC28.1 ...
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B (Invivogen) was added at 20 μg/mL ...
-
bioRxiv - Bioengineering 2022Quote: ... 293-cov2-sdf) or 2) Delta/B.1.617.2 variant) (Catalogue code: 293-SARS2-S-V8-dfur) were purchased from Invivogen. The cells were grown in DMEM media containing 10% Fetal Bovine Serum ...
-
bioRxiv - Genomics 2023Quote: ... cells were cultured in the same medium supplemented with 200 μg/ml HygromycinGold B (Invivogen ant-hg-2). To generate cells with constitutive BFP expression ...
-
bioRxiv - Molecular Biology 2020Quote: ... and hygromycin B (InvivoGen) as described previously (35) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and hygromycin B (InvivoGen) at 37ºC and 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... and hygromycin B (InvivoGen).
-
bioRxiv - Cell Biology 2023Quote: ... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
bioRxiv - Immunology 2020Quote: ... CpG-B ODN #1826 (Invivogen) was used at 5 μg/ml for stimulation in all experiments.
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... and 250ug/mL Hygromycin B (InVivoGen)) ...
-
bioRxiv - Immunology 2024Quote: Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded as 0.3*106 cells in 6-wells plate followed by treatment for 4 h with 333 nM of Torin 1 (InvivoGen) alone or in combination with 200 nM of Bafilomycin A1 for 1 h.
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated B cells were resuspended in B-LCL-medium containing 2.5 μg/ml CpG ODN 2006 (InvivoGen) and 30 μg/ml holo-transferrin (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2022Quote: ... After 2 to 6 minutes of gentle manual shaking in ice cold PBS with 1% (v/v) primocin (InvivoGen), the intestinal pieces were inspected microscopically (x100 magnification ...
-
bioRxiv - Biophysics 2021Quote: ... and 250 μg/ml Hygromycin B (Invivogen). After 2–3 weeks ...
-
bioRxiv - Immunology 2020Quote: ... B-glucan peptide (BGP) 100ug/mL (Invivogen), high mobility group box 1 (HMGB1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and hygromycin B (InvivoGen, ant-hg-1). To induce the expression of the integrated genes ...
-
bioRxiv - Biochemistry 2022Quote: ... Hygromycin B-Gold (75 μg/mL; Invivogen), blasticidin (10 μg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... and 200 µg/mL Hygromycin B (Invivogen).
-
bioRxiv - Microbiology 2020Quote: ... and 200 µg/mL Hygromycin B (Invivogen) for selection during every second passage ...
-
bioRxiv - Immunology 2020Quote: ... 2.5 μM CpG B (ODN 2006, Invivogen), 1 μg/ml anti-CD40 (G28.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 200μg/mL Hygromycin B Gold (InvivoGen) for HEK-Dual TLR3 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Hygromycin B Gold (InvivoGen, ant-hg-1), GeneticinTM G-418 Sulphate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Beta (B.1.351) (InvivoGEn, plv-spike-v3) and Delta (B.1.617.2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
bioRxiv - Biochemistry 2024Quote: ... and 100 μg/mL hygromycin B (Invivogen) in an orbital incubator at 37°C with 8% CO2.
-
bioRxiv - Biophysics 2024Quote: ... or Hygromycin B (InvivoGen, San Diego, CA) was added to the cell culture media in place of pen-strep to select for stably transfected cells ...
-
bioRxiv - Molecular Biology 2019Quote: ... livers of 10-week-old male or female mice were harvested 6 hours after tail-vein injection of LPS (2 mg/kg, Invivogen) or vehicle (PBS).
-
bioRxiv - Plant Biology 2021Quote: ... Transgenic Col-0 (LUC) plants were selected on 1/2 MS medium supplemented with 50 μM hygromycin B (InvivoGen, Cat No. ant-hg-5). LUC activity was confirmed as described above ...
-
bioRxiv - Cell Biology 2021Quote: ... selected with 180 µg/ml hygromycin B (Invivogen). Stable clonal cell lines were isolated by dilution into 96 well plates from the pooled stable cell lines.
-
bioRxiv - Neuroscience 2021Quote: ... The cells were selected with Hygromycin B (Invivogen) 200 μg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Hygromycin B Gold (50 μg/ml, InvivoGen) as selection antibiotics ...
-
bioRxiv - Cell Biology 2020Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Cell Biology 2019Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Immunology 2021Quote: ... P1 and B.1.429 were purchased from InvivoGen while others were made by us or collaborators ...
-
bioRxiv - Genomics 2022Quote: ... 150 ug/mL hygromycin B Gold (Invivogen # ANTHG1) was added for TOP2A-Venus selection ...
-
bioRxiv - Microbiology 2022Quote: ... pH5.5) supplemented with 70μg/ml hygromycin B (InvivoGen) or 70μg/ml nourseothricin (ClonNAT ...
-
bioRxiv - Immunology 2023Quote: ... and Delta (B.1.617.2) (InvivoGen, plv-spike-v8). Plasmids encoding the S protein from the Omicron variants (B.1.1.529 and BA.2 ...
-
bioRxiv - Immunology 2022Quote: ... and selected with 200μg/mL Hygromycin B (Invivogen) two days post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... and 100 µg/ml of hygromycin B (Invivogen). Expression of NS4B-APEX protein was induced by incubating the cells with 1 ng/ml of doxycycline (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were harvested from the 24-well plate when confluent by trypsinizing and transferring to a single well of a 6-well plate in 2 mL of medium supplemented with 1 μg/mL puromycin (Invivogen ant-pr). Cells were trypsinized daily (typically 3 d ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were harvested from the 24-well plate when confluent by trypsinizing and transferring to a single well of a 6-well plate in 2 mL of medium supplemented with 1 μg/mL puromycin (Invivogen ant-pr). Cells were trypsinized daily (typically 3 d ...
-
bioRxiv - Immunology 2023Quote: ... anti-hIL-6-IgG (Invivogen) or mouse IgG1 kappa Isotype Control (eBioscience ...
-
bioRxiv - Cell Biology 2020Quote: ... and selected with 100 μg/ml Hygromycin B (Invivogen) and 10 μg/ml Blasticidin (Invivogen) ...
-
bioRxiv - Immunology 2021Quote: ... 10% FBS and 250μg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions by the NIAID SARS-CoV-2 Virology Core using DMEM medium supplemented with glutamax and 2% FBS ...