Labshake search
Citations for Invivogen :
1 - 50 of 596 citations for 6 Methyl 4 5 6 7 tetrahydrobenzo b thiophene 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 6-7 week-old BALB/c mice were ordered from Invivogen/Envigo and were allowed to acclimatize for 10 days prior to experimentation ...
-
bioRxiv - Immunology 2023Quote: ... or 1 μM 6-formylindolo[3,2-b]carbazole (FICZ [84], Invivogen). Cytokine blockade was achieved using IL-1 receptor A antagonist anakinra (10 μg/ml ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded as 0.3*106 cells in 6-wells plate followed by treatment for 4 h with 333 nM of Torin 1 (InvivoGen) alone or in combination with 200 nM of Bafilomycin A1 for 1 h.
-
bioRxiv - Cell Biology 2023Quote: ... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
bioRxiv - Immunology 2023Quote: ... The Class B CpG ODN2006 (ODN 7909, PF_3512676, sequence: 5’-tcgtcgttttgtcgttttgtcgtt-3’, Invivogen) was diluted in sterile endotoxin-free water ...
-
bioRxiv - Molecular Biology 2020Quote: ... Disease was induced between 6 and 10 weeks of age using 3 mg curdlan (InvivoGen) administered by intraperitoneal injection ...
-
bioRxiv - Immunology 2023Quote: ... anti-hIL-6-IgG (Invivogen) or mouse IgG1 kappa Isotype Control (eBioscience ...
-
bioRxiv - Microbiology 2022Quote: ... the medium was further supplemented with puromycin (7 μg/ml for selection of clones or 6 μg/ml for maintenance of cell lines; Invivogen) and/or hygromycin (100 μg/ml for selection of clones or 70 μg/ml for maintenance of clones ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... or hygromycin B for 7 days (500 µg/ml, InvivoGen). Cells were transfected using GeneJuice (Merck ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 6 ug/mL blasticidine (Invivogen). 293T-Lα were cultured in DMEM medium (Gibco ...
-
bioRxiv - Cancer Biology 2021Quote: ... 6-8 weeks old CM knock-in mice were injected intraperitoneally with polyinosinic–polycytidylic acid [poly (I:C)] (InvivoGen, tlrl-picw-250) at 14 mg/kg/dose every other day for a total of 7 doses ...
-
bioRxiv - Bioengineering 2022Quote: ... CD8+ T cells and 5×104 NALM-6 cells were plated with 0.5-1 ng/mL blinatumomab (Invivogen) and cytokine ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... or 6 µg/mL of blasticidine S (InvivoGen) for 10 days ...
-
bioRxiv - Microbiology 2020Quote: ... Poly I:C (31852-29-6) was from InvivoGen.
-
bioRxiv - Microbiology 2024Quote: ... Poly(I:C) (31852-29-6) was from InvivoGen, France ...
-
bioRxiv - Bioengineering 2022Quote: ... (3) LPS and 150 μg/ml Polymyxin B (Invivogen) for 45 and 90 min ...
-
bioRxiv - Immunology 2020Quote: ... FSL1 (TLR2/6; tlrl-fsl; Invivogen, 100 ng/ml), LPS 0111:B4 (TLR4 ...
-
bioRxiv - Microbiology 2023Quote: ... or 6 ng/ml blasticidin (InvivoGen, Cat# ant-bl). Single-cell clones were isolated by the limiting dilution of the drug-resistant cell pool and expanded ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Mycoplasma testing within 6 months of use (InVivoGen). Cell lines were maintained in culture at 37°C in 5% CO2.
-
bioRxiv - Genomics 2019Quote: ... at 37°C and 5% CO2 for 6 h (ex vivo culture) or treated with 20 ng/mL Lipopolysaccharide (LPS) (tlrl-3pelps, Invivogen) for 6 h (LPS stimulation) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Treatment was initiated when tumors reached 5–6 mm in size and was given twice a week: 1 μg MPLA/tumor (#vac-mpls, InvivoGen) and indicated doses of mouse IFNγ (#485-MI/CF ...
-
bioRxiv - Immunology 2022Quote: ... shControl and shLRBA HeLa cells were seeded at 0.3*106 cells in 6 well-plates followed by treatment for 16 h or 24 h with 5 μM of MG132 (InvivoGen) alone or in combination with 100 nM of Bafilomycin A1 for 3 h ...
-
bioRxiv - Immunology 2024Quote: ... C57BL/6 mice were immunized with Spike protein (5 µg, Bio-Techne) in presence of CpG adjuvant (10 µg, ODN1826, Invivogen) according to the immunization protocol in Figure 1 ...
-
bioRxiv - Bioengineering 2022Quote: ... C57BL/6 mice were treated with 200ug poly(I:C) (Invivogen) for 2 days ...
-
bioRxiv - Immunology 2023Quote: ... we immunized three groups of C57BL/6 mice (n=9) with 5 µg protein antigens adjuvanted with 500 µg alum (Alhydrogel®, Invivogen) and 20 µg CpG (ODN 1826 ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg/mL) for 6 hr using LyoVecTM (InvivoGen, tlrl-patc) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... and another 1 μg/ml of anti-hIL-6-IgG (Invivogen) or mouse IgG1 kappa Isotype Control were added to the wells after 2 days of co-culture.
-
Inhaled CpG increases survival and synergizes with checkpoint inhibition in lymphangioleiomyomatosisbioRxiv - Immunology 2023Quote: Mice received CpG class B (5 μg/10 μg) 2x/week (Invivogen, tlrl-1826-5), in 50 μL of PBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transduced with retrovirus in the presence of 6 μg/ml protamine sulfate and selected with 5 ug/ml Blasticidin (InvivoGen #ant-bl-05) for 5 days.
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected with 5 μg/mL hygromycin B Gold (Invivogen). RNAi was induced with 1 μg/mL tetracycline (Sigma).
-
bioRxiv - Immunology 2019Quote: ... 1 μg/ml synthetic (B) form DNA analog poly(deoxyadenylic-deoxythymidylic) acid (poly(dA:dT)) (Invivogen) or 400 nM dsDNA containing GATC or Gm6ATC sequences ...
-
bioRxiv - Microbiology 2019Quote: ... polyinosinic-polycytidilic acid (polyIC) at 3 and 30 ng/mL (Invivogen), type-I interferon receptor inhibitor (IFNARinh ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2023Quote: ... TLR2/TLR1 ligand Pam3CSK4 and TLR2/6 ligand FSL-1 were from InvivoGen: All LPS were resuspended in sterile PBS 1x.
-
bioRxiv - Immunology 2022Quote: ... Class B CpG oligonucleotide 1826 and polyinosinic-polycytidylic acid (Poly(I:C) HMW) were purchased from InvivoGen.
-
bioRxiv - Microbiology 2021Quote: ... 5 μg/ml hygromycin B (Calbio-chem. 10 μg/ml blasticidin (InvivoGen). Independent clones were obtained by serial dilution.
-
bioRxiv - Microbiology 2022Quote: ... The parasites were selected with 5 μg/mL hygromycin B Gold (Invivogen). Overexpression was induced with 1 μg/ml tetracycline (Sigma-Aldrich).
-
bioRxiv - Immunology 2022Quote: ... irradiated splenocytes from naive C57Bl/6 mice were pulsed with 0.5mg/ml ovalbumin (InvivoGen). CD8+ T cells were isolated from the spleens of the vaccinated mice using CD8 magnetic microbeads (Miltenyi ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected and maintained for 6 days with 750 ng/µl Zeocin (Invivogen) until harvest on day 7.
-
bioRxiv - Cell Biology 2024Quote: ... Cells were selected with 100 µg/mL Hygromycin B Gold (Invivogen, #ant-hg-5). Selected clones were isolated and GFP expression was confirmed by Western blotting and flow cytometry.
-
bioRxiv - Molecular Biology 2023Quote: ... DF-1 chicken fibroblasts were stimulated with the synthetic TLR2/6 antagonist Pam2CSK4 (InvivoGen tlrl-pms) at a final concentration of 10 µg/ml for the indicated times prior to lysis or fixation ...
-
bioRxiv - Systems Biology 2021Quote: ... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... and cells were cultured for 24 hours before selection with 6 μg/mL of blasticidine S (InvivoGen) for 10 days ...
-
bioRxiv - Microbiology 2022Quote: ... Positive controls were conducted by the addition of 1.25 µg/mL triDAP 6 hpi (InvivoGen, Toulouse, France). Stimulation of NOD1 was measured at OD600 nm 18 hpi and 24 hpi (corresponding to treatment durations of 12 h and 18 h ...
-
bioRxiv - Immunology 2023Quote: Mice of the C57BL/6 genetic background (8 – 14 weeks old) were immunised with EndoFit Ovalbumin (OVA) (Invivogen) or SARS-CoV-2 RBD ...
-
bioRxiv - Cell Biology 2024Quote: ... Flip-In T-Rex cells were maintained using hygromycin B (30 µg/mL, InvivoGen, ant-hg-5) and blasticidin (30 µg/mL ...
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B (Invivogen) was added at 20 μg/mL ...
-
bioRxiv - Immunology 2022Quote: ... Cells were washed and cultured for 5-7 days in the presence of puromycin (2 µg/ml, InvivoGen). Selected cells were expanded ...
-
bioRxiv - Immunology 2023Quote: ... mice were immunized with 50 μg (day 3 analysis) or 100 μg (day 7 analysis) chicken ovalbumin (OVA) protein (InvivoGen) in PBS ...