Labshake search
Citations for Invivogen :
1 - 50 of 50 citations for 4 phenoxypropiophenone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... + 4 μg/ml Blasticidin (Invivogen). In order to knock-out SLX4 gene in these cells ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg/μL Zeocin (Invivogen) were added to culture media ...
-
bioRxiv - Physiology 2019Quote: ... and 4 µg/ml blasticidin (InvivoGen). Monoclonal cell lines were tested for robust expression of E2GFP and FaNaC by fluorescence microscopy and patch clamp electrophysiology ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μg ml-1 puromycin (InvivoGen), and grown at 37 °C in an atmosphere containing 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... 4 µg cGAMP (Invivogen, San Diego, Californien, USA), 4 µg c-di-UMP (Invivogen ...
-
bioRxiv - Immunology 2020Quote: ... for 4 hours and 10 μM nigericin (InvivoGen) for an additional 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and assayed with QUANTI-Luc 4 reagent (Invivogen). Luminescence was read immediately with an Envision system.
-
bioRxiv - Immunology 2023Quote: ... selective medium containing Puromycin (4 μg/ml, InvivoGen) was added and after 7 days cells were sorted using FACS Aria (BD ...
-
bioRxiv - Immunology 2020Quote: ... and selected with 4 μg mL−1 puromycin (InvivoGen) for two weeks.
-
bioRxiv - Microbiology 2019Quote: ... Miltenyi, 1000U/mL) and interleukin-4 (IL-4, Miltenyi, 1000U/mL) for 5 days before addition of lipopolysaccharide (LPS, Invivogen, 50 ng/mL) for 2 further days.
-
bioRxiv - Cell Biology 2020Quote: ... Stable transformants were selected using 4 μg/mL Blasticidin (Invivogen) and individual colonies were picked ...
-
bioRxiv - Immunology 2021Quote: ... 4 µg c-di-UMP (Invivogen, San Diego, Californien, USA) or mock-electroporated using a Gene Pulser Xcell Electroporation instrument (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: HEK-Blue™ IL-4/IL-13 cells (InvivoGen, France) were cultured according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
bioRxiv - Systems Biology 2023Quote: ... TLR4 agonist at 4 ng/mL (LPS-B5, Invivogen, San Diego, CA), BTC at 40 ng/mL (human recombinant Betacellulin protein ...
-
bioRxiv - Immunology 2023Quote: ... cells were transferred to selective medium containing 4 µg/mL Blasticidin (Invivogen) (MC38-B2m-/- transduced with Her2/neu ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 10 mg/kg anti-CTLA-4 (clone 9D9, cat. mctla4-mab10, InvivoGen). Antibodies were administered twice weekly for a maximum of four weeks.
-
bioRxiv - Immunology 2020Quote: ... the cells were primed for 4 h with 500 ng/mL ultrapure LPS (InvivoGen). The supernatant was discharged and macrophages were infected with trypomastigote forms of T ...
-
bioRxiv - Biochemistry 2023Quote: ... and 50 µL of the working solution of the QUANTI1Luc 4 Lucia/Gaussia reagent (Invivogen) was added ...
-
Vaccinia virus-based vaccines confer protective immunity against SARS-CoV-2 virus in Syrian hamstersbioRxiv - Immunology 2021Quote: ... boost 4 weeks later of 5 μg recombinant spike protein (aa 14-1209) in 1% alhydrogel (Invivogen) into the right hind limb ...
-
bioRxiv - Microbiology 2020Quote: ... thuringiensis-infected mice was intravitreally treated with the synthetic TLR2/4 inhibitor OxPAPC (Invivogen; 30 ng/μl) (WT+OxPAPC ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were selected 24 h post infection in 4 µg/ml Blasticidin (Invivogen, ant-bl-1) or 100 µg/ml of hygromycin (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... mice were primed by intraperitoneal injection of low molecular weight Poly(I:C) (LMW, InvivoGen; 4 mg/kg) followed 6h later by intraperitoneal challenge with LPS (L2630 ...
-
bioRxiv - Neuroscience 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). Neurons infected with GCaMP6f as stated above were infected with AAV9-hSyn-Cre (Addgene #105553-AAV9 ...
-
bioRxiv - Immunology 2022Quote: The following in vivo treatment regimens were used in this study: DMXAA (5,6-dimethylxanthenone-4-acetic acid, Invivogen): 20mg/Kg intraperitoneal (i.p.) ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). For calcium imaging experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa Cyclin B1-GFP cells were grown in media containing 4 μg/ml blasticidin (Invivogen # ant-bl-05). HeLa Cyclin A2-GFP cells 25 were grown in media containing 9 μg/ml blasticidin (gifts of Francis Barr) ...
-
bioRxiv - Immunology 2022Quote: 50μg biotinylated NS1 protein or 50μg (4-hydroxy-3-nitrophenyl)-acetyl(15)-OVA (NP-OVA) was adsorbed to 100μg alhydrogel alum (InVivoGen) in a total of 200μL per mouse for 30 min at room temperature ...
-
bioRxiv - Immunology 2019Quote: ... and stimulated with 1 U/mL of IL-4 (Miltenyi) and 5 ng/mL IL-5 (Miltenyi) supplemented with 1μg/mL LPS (Invivogen) or 10μg/mL CpG ODN (Invivogen ...
-
bioRxiv - Biochemistry 2021Quote: PMA-differentiated THP1 macrophages in 24-well plates were pretreated with fatty acids (2.5 μM and 10 μM) for 30 min prior to stimulation with 4 μg/mL cGAMP (InvivoGen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µl UV-treated sample was inoculated onto 4×104 cells/ well of HEK-Blue IFNα/β cells (InvivoGen) in 96-well plates ...
-
bioRxiv - Immunology 2023Quote: ... Culture supernatants from THP-1 Dual cells (20 µl) were mixed with QUANTI-Luc 4 Lucia/Gaussia reagent (Invivogen), and luminescence was measured by a luminometer ...
-
bioRxiv - Genetics 2023Quote: ... Ganciclovir selection was conducted for 4 days under 10 μM ganciclovir/culture medium (#sud-gcv; InvivoGen, San Diego, CA) after G418 selection or 8 days after single-cell sorting ...
-
bioRxiv - Immunology 2023Quote: ... or RPMI1640 (ATCC) supplemented with 10% FBS and 2 mM L-Gln (MC38) and 4 µg/mL Blasticidin (InvivoGen) (MC38-Her2-B2m-/-) ...
-
bioRxiv - Immunology 2020Quote: ... Animals received 1 μg of the TLR-2 ligand Pam3Cys-Ser-(Lys)4 trihydrochloride (Pam3Cys) (Invivogen, San Diego, CA, USA), 1 μg of the TLR-4 ligand LPS (Sigma-Aldrich Corp. ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then plated on 12 mm cover slides in a 24-wells plate and then treated 4 h with 100 nM Bafilomycin A1 (Invivogen), 333 nM Torin 1 (Invivogen ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded as 0.3*106 cells in 6-wells plate followed by treatment for 4 h with 333 nM of Torin 1 (InvivoGen) alone or in combination with 200 nM of Bafilomycin A1 for 1 h.
-
bioRxiv - Immunology 2024Quote: ... with WT or Sulf2+/- antigen-presenting cells (BMDM or DCs) activated with LPS (100 ng/ml LPS, 4 h, InvivoGen). As a source of antigen ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Omicron Variant (B.1.1.529/BA.1) pLV-SpikeV11) and Omicron Variants (BA.4/BA.5) pLV-SpikeV13) were purchased from InvivoGen (San Diego, CA). The human T-Cell lymphoma Jurkat (E6-1 ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-ppp-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (Catalog Code, lyec-12, InvivoGen), following the manufacturer’ ss instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (InvivoGen, Catalog Code. lyec-12, InvivoGen) following the manufacturer’ ss instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma infection was conducted every 3–4 months using the PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (ant-pm-1, InvivoGen, San Diego, California, USA). Cultures were incubated at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM cyclic di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM c-di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes.
-
bioRxiv - Cancer Biology 2023Quote: ... All cells were routinely confirmed to be negative for mycoplasma infection every 3–4 months using PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Bioengineering 2023Quote: ... 4 or 8 µg/ml) or ss-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (InvivoGen, Catalog Code. lyec-12, InvivoGen) following the manufacturer’ ss instructions ...