Labshake search
Citations for Invivogen :
201 - 250 of 1614 citations for 7 7 4 4 Bipiperidine 1 1 diyldi 2 1 ethanediyl bis 10 methoxy 7H pyrido 4 3 c carbazole tetramethanesulfonate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Immunology 2024Quote: ... with WT or Sulf2+/- antigen-presenting cells (BMDM or DCs) activated with LPS (100 ng/ml LPS, 4 h, InvivoGen). As a source of antigen ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Cell Biology 2019Quote: ... and primocin (100 μg ml-1) (ant-pm-1, InvivoGen).
-
bioRxiv - Cell Biology 2024Quote: ... and blasticidin (30 µg/mL, InvivoGen, ant-bl-1: 1). The expression of proteins was induced with tetracyclin (1 µg/mL ...
-
bioRxiv - Pathology 2023Quote: ... and 1% gentamycin (G418, Invivogen cat. no. ant-gn-1). Primary human aortic SMCs (hVSMCs) ...
-
bioRxiv - Bioengineering 2022Quote: ... 1× Primocin (InvivoGen) and 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2022Quote: ... 1× Primocin (InvivoGen) and 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Systems Biology 2020Quote: ... Non-transduced cells were eliminated by selection with 10 μg mL−1 blasticidin (Invivogen). Selection was maintained until non-transduced controls reached 0% viability twice in succession (~ ten doublings) ...
-
bioRxiv - Microbiology 2021Quote: ... transfected cells were selected with 10 μg/ml of puromycin (Invivogen # ant-pr-1). After 48 h ...
-
bioRxiv - Microbiology 2023Quote: ... transfected cells were selected with 10 μg/ml of puromycin (Invivogen # ant-pr-1). After 48 h ...
-
bioRxiv - Cell Biology 2023Quote: ... Transduced cells were selected with 10 μg/mL puromycin (InvivoGen, cat#ant-pr-1) or 10 μg/mL blasticidin (InvivoGen ...
-
bioRxiv - Microbiology 2020Quote: ... Mice were immunised intramuscularly (IM) with 20 μg of the entire ectodomain of P113 (18) adjuvanted in a 1:1 ratio of Addavax (Invivogen, cat no. vac-adx-10) followed by two similar IM boosts at 2 week intervals ...
-
bioRxiv - Microbiology 2019Quote: ... Transduced cells were selected with 3 μg/mL puromycin (InvivoGen, San Diego, CA, catalogue #ant-pr-1), 10 μg/mL blasticidin (InvivoGen ...
-
bioRxiv - Genomics 2022Quote: ... and incubated in fresh 3 mM EDTA in ice cold PBS with 1% (v/v) primocin (InvivoGen) for 40 min at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... Transduced cells were selected with 3 μg/mL puromycin (InvivoGen, San Diego, CA, catalogue #ant-pr-1) for 3 days ...
-
bioRxiv - Immunology 2021Quote: ... or 2’-3’cGAMP (4µg/ml, Invivogen) for the specified times ...
-
bioRxiv - Immunology 2024Quote: ... or 2µg/mL 2’,3’-cGAMP (InvivoGen), or 2µg/mL poly(I:C ...
-
bioRxiv - Neuroscience 2021Quote: ... resiquimod (2 mg/kg of a 1 mg/ ml solution in PBS, Invivogen tlrl-r848), were administered subcutaneously on E12.5 between 9:00-11:00 am and their conditions were monitored to ensure that there was no sign of any severe sickness symptoms or abnormalities.
-
bioRxiv - Immunology 2024Quote: ... 50 μM 2-mercaptoethanol (Fisher; 31350010) and 100 μg/ml Normocin (InvivoGen; ant-nr-1)) ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1% Primocin (Invivogen #ant-pm-1, San Diego, CA, USA), and cells were filtered and plated at a density of 100,000 cells/cm2 onto uncoated tissue-culture flasks ...
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with 100 μg ml-1 primocin (ant-pm-1, InvivoGen) in the apical channel.
-
bioRxiv - Immunology 2020Quote: ... Human THP-1 monocyte-like cells (THP-1 Lucia ISG, Invivogen) were maintained in RPMI 1640(Thermo Fisher cat ...
-
bioRxiv - Immunology 2020Quote: ... 5μg of PR8-HA protein with Addavax (1:1 ratio; InvivoGen) and 0.5% tattoo ink was injected into the left quadriceps and right gastrocnemius (50 μL per site) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2ug mL-1 (InvivoGen, ant-pr-1), the jurkat cells were harvested at several different timepoints ranging from 7 days to 14 days ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2µg mL-1 (InvivoGen, ant-pr-1), the nucleofected cells were harvested at several different timepoints ranging from 6 days to 41 days ...
-
bioRxiv - Immunology 2024Quote: ... Cells were stimulated with LPS (1 ng ml-1; Invivogen, USA), FSL-1 (100 ng ml-1 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Primocin (Invivogen #ant-pm-1, San Diego, CA, USA). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... Clec7a or Dectin-1 (rat monoclonal, 1:100; Invivogen, mabg-mdect), Trem2 (sheep polyclonal ...
-
bioRxiv - Microbiology 2024Quote: ... each sample was mixed 1:1 with MagicMouse (Gentaur or Invivogen) and immunised with 100 µL this solution ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Microbiology 2022Quote: ... the medium was further supplemented with puromycin (7 μg/ml for selection of clones or 6 μg/ml for maintenance of cell lines; Invivogen) and/or hygromycin (100 μg/ml for selection of clones or 70 μg/ml for maintenance of clones ...
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 1% sorbitol and either 50 mg/liter phleomycin (after adjusting the media to pH 7) or 200 mg/liter hygromycin Gold (both InvivoGen). For solid medium ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 1% sorbitol and either 20 mg/liter phleomycin (after adjusting the pH to 7) or 150 mg/liter hygromycin Gold (both InvivoGen). For solid medium ...
-
bioRxiv - Genetics 2023Quote: ... supplemented with 1% sorbitol and either 50 mg/liter phleomycin (after adjusting the pH to 7) or 200 mg/liter hygromycin Gold (both InvivoGen). For solid medium ...
-
bioRxiv - Immunology 2024Quote: ... all cells were centrifuged for 5 minutes at 300 x g and the medium was replaced with myeloid medium containing 7 µg/mL puromycin (Invivogen) to select cells transduced for 72 hours.
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in the medium with 10 μg/mL blasticidin (ant-bl-1, InvivoGen) for at least two weeks to achieve complete antibiotic selection before using for other experiments.
-
bioRxiv - Microbiology 2020Quote: ... Selection drugs were added to the medium as appropriate: 10 µg mL-1 blasticidin (InvivoGen), 40 µg mL-1 puromycin (InvivoGen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pen/strep amended with 10 ug/mL puromycin (ant-pr-1, InvivoGen, San Diego, CA). Following daily replacement of media with puromycin ...
-
bioRxiv - Microbiology 2024Quote: ... cells were passaged in selection medium containing 10 µg/ml blasticidin (ant-bl-1, InvivoGen). BEAS-2B-Cas9 were later transduced with lentiviruses encoding for GSDMD ...
-
bioRxiv - Cell Biology 2023Quote: ... co-transfected cells were selected in culture medium supplemented with 3 μg/ml puromycin (Invivogen, ant-pr-1), until selection was complete after about 48 h ...
-
bioRxiv - Microbiology 2021Quote: ... were immunized with 3 ugs of purified RBD of SARS-CoV-2 mixed with 10 ugs of poly I:C (Invivogen) twice with 3 weeks interval (17 ...
-
bioRxiv - Microbiology 2021Quote: BALB/c mice were immunized with 10 µg of SARS-CoV-2 RBD adjuvanted with 50% AddaVax™ (InvivoGen), via intramuscular route (i.m.) ...
-
bioRxiv - Bioengineering 2024Quote: ... 1% P/S and 100 µg/ml Normocin (Invivogen ant-nr-1). 10 µg/ml of Blasticidin (Invivogen ant-bl-05 ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected with 1 µg/ml puromycin (Invivogen ant-pr-1).
-
bioRxiv - Cell Biology 2023Quote: ... Cells were selected with 1 µg/mL puromycin (ant-pr-1, Invivogen) and pooled if the expression was homogeneous or cloned otherwise.
-
bioRxiv - Immunology 2022Quote: ... 2 mM (peritoneal macrophages) ATP or 50 µM (THP-1 differentiated macrophages) R837 (InvivoGen, tlrl-imqs) for 30-60 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then selected in the culture medium containing 2 µg/ml puromycin (InvivoGen, ant-pr-1).
-
bioRxiv - Microbiology 2023Quote: ... Envelope defective virus was pseudotyped with HU-1 SARS-CoV-2 Spike protein (pLV-Spike, Invivogen) and used for single round infection assays ...
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...