Labshake search
Citations for Zymo Research :
1 - 50 of 6044 citations for Urea Nitrogen Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... root tissues were ground in liquid nitrogen and RNA was extracted using Quick-RNA Kits (Zymo research). RNA libraries were prepared for sequencing using standard Illumina protocols at the Salk Next Generation Sequencing Core (NGS) ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were ground in liquid nitrogen and total RNA was extracted using the Quick-RNA Plant Kit (Zymo Research). An on-column DNase I step was added using RQ1 DNase (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA was released by proteinase K treatment in urea and recovered by phenol chloroform extraction and column purification (RNA Clean-Up kit; Zymo Research). Input samples were dephosphorylated and 3’-linker ligated to a custom oligonucleotide primer and all samples (IPs and SMInputs ...
-
bioRxiv - Microbiology 2022Quote: ... In vitro transcripts were gel purified using 8 M urea 10% PAA and the ZR small-RNA PAGE Recovery Kit (Zymo Research). The in vitro transcribed RNAs carry three additional G nucleotides at their 5΄ ends originating from the T7 promoter ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Samples were frozen in liquid nitrogen and mechanically homogenized before total RNA extraction was performed using the Quick-RNA™ Microprep Kit (Zymo Research). 200ng from each sample were transferred to GenTegra-RNA tubes (Syntezza Bioscience ...
-
bioRxiv - Genetics 2019Quote: ... Small RNAs were sized selected and purified from a 15% denaturing polyacrylamide-urea gel using the ZR small-RNA™ PAGE Recovery Kit (Zymo Research). For oxidized RNA library preparations ...
-
bioRxiv - Genomics 2020Quote: ... and cambium using a LiCl-Urea buffer followed by cleanup using Zymo columns and reagents (Zymo Research, Irvine, CA). RNA quality was assessed using an Experion Electrophoresis System (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... of PCR-amplified parts from the genomic DNA of a phiX174 bacteriophage genome (Supplementary Table S4), purified from a 10% urea-PAA gel (RNA PAGE Recovery, (Zymo). Determination of RNA concentration was performed using the Qubit RNA HS Assay kit (Thermo Fisher) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... strains were struck to synthetic defined (SD) media (CSM minus arginine, yeast nitrogen base, glucose) containing 5-Fluoroorotic Acid (5FOA) (Zymo Research, Irvine, CA, USA). to isolate cells that spontaneously lost pTC416-SEC53 ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2021Quote: ... the RCC kit (Zymo Research).
-
bioRxiv - Developmental Biology 2020Quote: ... or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNA purification kit (Zymo). cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo Research). For each transformation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli Transformation Kit (Zymo Research), and transformations were carried out using 50 ng of ligation product or plasmid ...
-
bioRxiv - Genetics 2023Quote: ... ZymoPure Midiprep Kit (Zymo Research) was used to prepare donor constructs for embryo injection ...
-
bioRxiv - Microbiology 2024Quote: ... Correct amplicons were isolated by Zymo PCR purification kit (Zymo Research). The PCR products were cloned into a PCR linearized pEcgRNA-guide plasmid to make the pEcgRNA-guide-RT plasmid using In-fusion® HD-cloning kit (Takara Bio ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli Transformation Kit (Zymo Research). Plasmids were prepared following standard protocols ...
-
bioRxiv - Biochemistry 2021Quote: ... Zyppy™ Plasmid Miniprep kit and DNA Clean & Concentrator™ kit were purchased from Zymo Research ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total RNA was isolated from using DNA/RNA Duet Kit miniprep kit (Zymo Research, USA).
-
bioRxiv - Genetics 2022Quote: ... cerevisiae temperature-sensitive strain TSA64 en masse using EZ Kit Yeast Transformation kit (Zymo Research). The entire transformed library was grown in selective media (YPD + clonNAT ...
-
bioRxiv - Genetics 2024Quote: ... cerevisiae double mutant strain sml1Δ rad53Δ using the EZ Kit Yeast Transformation kit (Zymo Research) to obtain ∼1,000,000 clones per region ...
-
bioRxiv - Synthetic Biology 2022Quote: ... whereas Zymoclean Gel DNA Recovery Kit and Zymoprep Yeast Plasmid Miniprep Kits were purchased from Zymo Research (Irvine ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted using a ‘Quick-DNA™’ Fungal/Bacterial 96 kit extraction kit (Zymo Research). A Nextera DNA library preparation kit (Illumina ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and Zymoclean Gel DNA Recovery Kit and Zymoprep Yeast Plasmid Miniprep Kits were purchased from Zymo Research (Irvine ...
-
bioRxiv - Neuroscience 2023Quote: ... and total RNA was isolated by using a commercial kit (RNA Clean & Concentrator kits, ZYMO Research). Total RNA (500 ng each ...
-
bioRxiv - Microbiology 2019Quote: ... YeaStar Genomic DNA kit (Zymo Research), and a protocol modified from Sergey Kryazhimskiy and Andrew Murray lab ...
-
bioRxiv - Synthetic Biology 2019Quote: ... using ZymoPURE Midi Kit (Zymo Research). CFPS reactions under oxidizing conditions conducive to disulfide bond formation were performed similarly to standard CFPS reactions except for the use of a 30 minute preincubation of the lysate with 14.3 µM IAM and the addition of 4 mM oxidized L-glutathione GSSG ...
-
bioRxiv - Microbiology 2021Quote: ... The Quick-DNA miniprep kit (Zymo) was used according to manufacturer’s instructions for cell suspension samples ...
-
bioRxiv - Genetics 2021Quote: ... or Direct-zol RNA kit (Zymo). The worm and egg pellets were resuspended in lysis buffer (either homemade supplemented lysis buffer or the kit lysis buffer ...