Labshake search
Citations for Zymo Research :
1 - 50 of 6062 citations for Swine IL 4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... was used for the estimation of global 5-hmC and 5-mC levels by ELISA using the Quest 5-hmC ELISA kit and the 5-mC DNA ELISA kit (Zymo research Inc, USA) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... measured with the 5mC ELISA kit (Zymo Research), to 12 % of the total human 5-methylated cytosine (5mC ...
-
bioRxiv - Genomics 2023Quote: ... At least four million IL-1βlow and IL-1βhigh cells were collected for genomic DNA extraction using Quick-DNA FFPE Kit (Zymo Research). PCR reactions containing up to 10 μg genomic DNA in each reaction were performed using ExTaq DNA Polymerase with primers to amplify the sgRNAs ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ...
-
bioRxiv - Neuroscience 2023Quote: Genome-wide DNA methylation levels were determined using the 5-mC DNA ELISA Kit (Zymo Research, D5325) per the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: Global DNA methylation was performed in genomic DNA using 5-mC DNA ELISA kit (Zymo Research, USA) following manufacturer’s protocol and that described in (Valdivieso et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... Relative quantification of 5-methylcytosine (5-mC) over time was determined using the 5-mC DNA ELISA Kit (Zymo Research), using 100 ng of genomic DNA per sample as input ...
-
bioRxiv - Cell Biology 2022Quote: Total RNAs were extracted from BMDMs (male mice: 4 Cre+ and 4 Cre−) using the Quick-RNA miniprep plus kit (Zymo). With a minimum of 300 ng input RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... nucleus accumbens and lung of the 4 juvenile and 4 old female mice was bisulfite converted using the EZ DNA methylation Gold kit (Cat# D5006, Zymo Research) according to manufacturer’s instructions and eluted ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA samples were also used for global DNA methylation analysis using the 5-mC DNA ELISA Kit (Zymo Research, Irvine, CA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... control samples (n = 4, one for each extraction batch) using commercially available kits optimized for fecal-based microbial communities (Zymo fecal/soil kit), and some aliquots archived ...
-
bioRxiv - Immunology 2020Quote: ... according to the manufacturer’s protocol (for more than 4×106 cells) or Quick-RNA MicroPrep kit (Zymo research R1051 ...
-
bioRxiv - Genetics 2023Quote: ... we extracted DNA from 2–4 dpf whole larvae using the Quick-DNA Microprep Kit (D3021, Zymo Research). We then performed a PCR for GFP as well as a ‘junction PCR’ to amplify a region including both mitfa and GFP to ensure integration at the intended locus.
-
bioRxiv - Biophysics 2021Quote: ... Samples were then transferred in 4 ml tubes and processed for total RNA extraction with RNA micro kit (ZYMO REAGENT) according to company protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of the cultures were used for total RNA extraction using the Direct-zol RNA extraction kit (Zymo Research) and TRI Reagent (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: Tumors were then harvested 4 weeks post-injection and processed using Quick-DNA midiprep plus kit (Zymo Research Cat. #D4075). For each processed tumor ...
-
bioRxiv - Genomics 2020Quote: ... 4-S-UTP containing RNA was eluted in 100mM DTT buffer and purified with RNA Clean and Purification kit (Zymo Research) with in-column DNAse reaction to eliminate traces of genomic DNA ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was isolated from Vero cells after 4 days post infection using the Direct-zol RNA isolation kit (Zymo Research). 1 μg of RNA isolate was subjected to rRNA removal with the NEBNext rRNA Depletion Kit (NEB ...
-
bioRxiv - Bioengineering 2022Quote: The isolated yeast populations obtained after round 4 were subjected to colony screen and plasmid recovery by using Zymoprep kit (Zymo Research). The plasmids were transformed into E ...
-
bioRxiv - Genomics 2020Quote: ... 4-SUTP containing RNA was eluted in 100 mM DTT buffer and purified with RNA Clean and Purification kit (Zymo Research) with in-column DNAseq reaction to eliminate traces of genomic DNA ...
-
bioRxiv - Physiology 2020Quote: Total RNA was extracted from late third instar fat bodies (n = 4-6 pooled/sample) using a Direct-zol RNA MicroPrep kit (Zymo Research). DNAse-treated total RNA (1 µg ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were centrifuged 1 min at 12000 g at 4°C and RNAs were extracted from supernatants with Direct-zol RNA Mini Prep kit (Zymo Research), following manufacturer’s protocol and including the optional DNAse treatment step ...
-
bioRxiv - Developmental Biology 2024Quote: Total RNA from 105 days old CorticOs (N = 4; n = 6-8 per genotype) was extracted using the Direct-zol RNA Miniprep Plus kit (Zymo Research) following the manufacturer’s protocols ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from rosette tissue harvested at ZT 23 on day 25 post imbibition (n = 4 biological replicates) using the Direct-zol-96 MagBead RNA kit (Zymo Research). RNA was checked for degradation using a Tapestation 4150 (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... The genomic DNA of JLat cells and CD4 T cells from individuals #3 and #4 were extracted with a Quick-DNA Miniprep Plus kit (Zymo Research #D4068) according to the product protocol ...
-
bioRxiv - Plant Biology 2019Quote: Total RNA from 4 weeks old Arabidopsis thaliana WT Col-0 and mta mutant plants was isolated using Direct-zol™ RNA kit (Zymo Research). RNA was quantified by Qubit RNA Assay Kit (Life Technologies ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cells were then harvested by centrifugation at 3500g for 4 min and prepared for transformation using the Frozen-EZ Yeast Transformation II Kit (Zymo Research, Irvine, CA). For plasmid transformations ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of urine was added to 4 ml of 2X DNA/RNA Shield® (Zymo, USA). Serum and urine samples were stored and transported on ice to the Institute of Microbiology at Universidad San Francisco de Quito and thereafter maintained at −20°C until DNA extraction.
-
bioRxiv - Microbiology 2021Quote: ... cells collected by centrifugation (6000 xg, 10 min, 4°C) and DNA extracted using the ZR Fungal/Bacterial DNA Kit (Zymo Research, Irvine, CA, USA), following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: DNA from 32 skull base chordomas and 4 NP samples were bisulfite converted with EZ-96 DNA Methylation kit (Zymo Research, Orange, CA, USA) and used for genome-wide DNA methylation profiling with Methylation EPIC (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... we dissected embryonic tails at E12.5 (n = 4) and E14.5 (n = 4) and extracted RNA using 50 µl Direct-zol (Zymo Research) following the manufacturer’s protocol and used the same library preparation procedures as for the parental samples ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting product was purified using 4 spin columns (Zymo, DCC-25) to produce the round 1 product.
-
bioRxiv - Genomics 2023Quote: ... Libraries were eluted in DNA Elution Buffer (Zymo Research, Cat #D3004-4-10). The concentration and average size of the libraries was verified using the TapeStation DNA 5000 Assay Reagents and Screen Tapes (Agilent ...
-
bioRxiv - Genomics 2023Quote: ... The DNA pellet was eluted in elution buffer (D3004-4-10 Zymo Research) and incubated at 50°C for 10 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Genomics 2021Quote: ... Pellets were then resuspended in Zymo DNA elution buffer (Zymo, Cat No: D3004-4-10), and placed on the heat block at 65°C for 1 hour to completely dissolve the genomic DNA.
-
bioRxiv - Genetics 2023Quote: ... Microinjections were performed with 4-5 µg/µl (diluted in nuclease free water, Zymo Research) fas5 and GFP dsRNA on a Femtojet microinjector (Eppendorf ...
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 and 4 by lysing cells in the 6-well plate in RNA lysis buffer (Zymo) and freezing at −80 °C until extraction ...