Labshake search
Citations for Zymo Research :
1 - 50 of 6059 citations for Recombinant Mouse Kit His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Tagged DNA was purified with the DNA Clean & Concentrator-5 kit (Zymo Research) eluting with 14 µl EB buffer (Qiagen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The tagged DNA was purified with the DNA Clean ConcentratorTM5 Kit (Zymo Research). The samples were pre-amplified with the Nextera Index kit and the Nextera DNA Library Prep kit (both from Illumina) ...
-
bioRxiv - Immunology 2020Quote: ... The tagged DNA was purified using DNA clean and concentrator kit (Zymo research). Fluorescently labeled DNA was transferred on to Zeta probe membrane (Bio Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tagged DNA fragments were purified using the Clean & Concentrator-5 Kit (ZYMO, D4014), then subjected to PCR amplification and double-sided bead purification (to remove primer dimers and larger than 1,000 bp fragments ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant bacmid DNA was purified using the ZR Bac DNA Miniprep Kit (Zymo Research) and correctness of the transposed sequence was analyzed by PCR using pUC/M13 primers ...
-
bioRxiv - Microbiology 2019Quote: ... The cells were harvested and the protein was purified using His-Spin Protein Miniprep kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Recombinant reporter constructs were isolated using the ZymoPURE™ Plasmid Miniprep Kit (Zymo Research, #D4210), following the manufacturer’s protocol with the following minor modifications ...
-
bioRxiv - Systems Biology 2019Quote: ... SD -His with uracil and 5FOA (Zymo Research) was used to analyze the phase separation effects of a toxic Ura3p activity.
-
bioRxiv - Synthetic Biology 2024Quote: ... the constructed donor DNA fragment and recombinant plasmid pYlCas9 were simultaneously transformed into the targeted strain using the Frozen-EZ yeast transformation II Kit (Zymo Research). The amounts of donor DNA and plasmid pYlCas9 used were 1 μg and 500 ng ...
-
bioRxiv - Cell Biology 2020Quote: ... and primary mouse keratinocytes was isolated using Direct-zol RNA Microprep Kits (Zymo) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: RNA from mouse lungs was extracted using RNA Miniprep Plus Kit (Zymo Research). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: gDNA was isolated from mouse gastrocnemius using Quick-DNA Microprep Plus Kit (Zymo D4074). gDNA was amplified using CloneAmp™ HiFi PCR Premix (Takara 639298 ...
-
bioRxiv - Biochemistry 2020Quote: ... then loaded directly onto a Ni-NTA protein miniprep column (His Spin Protein Miniprep, Zymo Research). Protein was washed following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and total RNA of mouse organoids was isolated using Quick-RNA Miniprep Plus Kit (Zymo Research), and all of them were assessed for purity and quantity using a Nanodrop 1000 spectrophotometer ...
-
bioRxiv - Molecular Biology 2021Quote: ... pLXSP-16E7 or control vector infected primary mouse keratinocytes with the Quick-RNA Miniprep kit (Zymo Research). cDNA was synthesized with the Quantinova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from mouse hearts using either the Direct-zol RNA Miniprep kit (Zymo, cat# R2051) or the RNeasy Fibrous Tissue Mini Kit (QIAGEN ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from mouse hippocampus with the Quick-RNA Miniprep Plus Kit (Zymo Research, R1058) and RNA integrity was determined using Agilent Bioanalyzer ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA (400 ng) from mouse tail was bisulphite converted with the EZ DNA Methylation-Lightning kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was prepared from fibroblasts isolated from mouse hearts using Direct-zol RNA miniprep kit (Zymo Research). cDNA libraries were prepared using the NEBNext Ultra Directional Library Preparation Kit following rRNA depletion using the NEB rRNA depletion kit ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse back skin was homogenized and RNA was extracted using Quick-RNA Miniprep Kit (Zymo Research, Cat# R1054) per the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Total RNA was extracted from mouse tissues and HEK293 cells using Quick-RNA MiniPrep Kit (ZYMO Research, Irvine, CA). Five μg of treated RNA was used as template for first-strand cDNA synthesis by using RevertAid RT Reverse Transcription Kit (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: RNA was isolated from mouse iBAT following the standard protocol for the Direct-zol RNA Miniprep kit (Zymo Research) and assessed for quality on the Agilent 2200 TapeStation (Agilent Technologies) ...
-
bioRxiv - Systems Biology 2022Quote: Total RNA was extracted from mouse kidneys and livers by the Direct-zol™ RNA Purification Kits (Zymo Research). Purified RNA was reverse transcribed using the SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... After collection of TI and TS fractions 100 µl of His-affinity gel (i.e., Ni-NTA Magnetic Agarose Beads) (ZYMO Research) and 10 µl of protease inhibitor cocktail (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4sU-labelled mouse and Drosophila cells were mixed and RNA was extracted using the Direct-zol DNA/RNA Miniprep kit (Zymo Research) as per the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... genomic DNA was isolated from a small aliquot of mixed mouse and fly cells using Quick-DNA Miniprep kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from human iPSC-FBs and mouse Raw 264-7 cells using the Direct-Zol RNA kit (Zymo Research) according to manufacturer instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... Total RNA was then isolated from all mouse tissues using TRIzol reagent and RNA Isolation kits with on-column DNase treatment (Zymo Cat# R2072). cDNA synthesis was performed with random primers from the Protoscript cDNA synthesis kit (NEB Cat#E6560S) ...
-
bioRxiv - Microbiology 2022Quote: ... coli TOP10 cells were propagated in LB medium (ampicillin, 100 µg/ml) and used for recombinant plasmid DNA isolation (Zypy Plasmid Miniprep, Zymo Research). Prior to plasmid transformation to expression host E ...
-
bioRxiv - Developmental Biology 2021Quote: ... or Universal Methylated Mouse DNA Standard (Zymo Research) was bisulfite converted using EZ DNA Methylation-GoldTM Kit (Zymo Research) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Universally methylated mouse DNA standard (cat. no. D5012, Zymo Research) and Mlh1−/− tissues were used as Mlh1+/+ and Mlh1−/− allele controls ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Molecular Biology 2020Quote: ... Universally methylated mouse DNA standard (cat. no. D5012, Zymo Research, Irvine, CA) and genomic DNA extracted from normal spleen was used as positive and negative controls ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...