Labshake search
Citations for Zymo Research :
1 - 50 of 6055 citations for Rat Interleukin 8 Receptor Beta IL8RB CXCR2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... was used for the estimation of global 5-hmC and 5-mC levels by ELISA using the Quest 5-hmC ELISA kit and the 5-mC DNA ELISA kit (Zymo research Inc, USA) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... measured with the 5mC ELISA kit (Zymo Research), to 12 % of the total human 5-methylated cytosine (5mC ...
-
bioRxiv - Cell Biology 2022Quote: ... 8 were performed with the YeaStar RNA Kit (Zymo Research) following the instructions of the given protocol ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ...
-
bioRxiv - Neuroscience 2023Quote: Genome-wide DNA methylation levels were determined using the 5-mC DNA ELISA Kit (Zymo Research, D5325) per the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: Global DNA methylation was performed in genomic DNA using 5-mC DNA ELISA kit (Zymo Research, USA) following manufacturer’s protocol and that described in (Valdivieso et al. ...
-
bioRxiv - Zoology 2024Quote: ... These amplified products were then purified as above and restriction enzyme digested CCHa1R and CCHa2R sequences were ligated into pcDNA3.1+ and pBudCE4.1 mammalian expression vectors followed by bacterial transformation and plasmid DNA purification to obtain a large quantity of receptor constructs using ZymoPURE II Plasmid Midiprep Kit (Zymo Research, Tustin, CA, USA) following the manufacturer recommendation ...
-
bioRxiv - Pathology 2023Quote: ... Calculations of alpha and beta diversity were done by standard methodology by Zymo Research.
-
bioRxiv - Plant Biology 2023Quote: ... Relative quantification of 5-methylcytosine (5-mC) over time was determined using the 5-mC DNA ELISA Kit (Zymo Research), using 100 ng of genomic DNA per sample as input ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA samples were also used for global DNA methylation analysis using the 5-mC DNA ELISA Kit (Zymo Research, Irvine, CA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... gDNA was harvested from limb buds from E14.5 Fzd2tm1.1Nat or lung tissue from Fzd2tm1Eem 8-week-old mice using Quick-DNA™ Miniprep Plus Kit (Zymo Research). A modified PCR protocol was used [28] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and amplicons ranging from 0.2–8 kb were extracted and purified using the Zymoclean Gel DNA Recovery Kit (Zymo Research), quantified using a Qubit 2.0 fluorometer (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: Genomic DNA was extracted from 200-250µm-thick cryopreserved rat lung tissue using the Zymo Quick-DNA MicroPrep Kit (Zymo, Irvine, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Reactions were quenched with 8 volumes of ethanol and the DNA was recovered by using the DNA Clean and Concentrator kit (Zymo Research). DNA samples were digested to nucleosides using the Nucleoside Digestion Mix (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA pellet was resuspended in 20 µL 10 mM Tris pH 8 and further cleanup was done with a Zymo DNA Clean and Concentrator kit (Zymo Research).
-
bioRxiv - Microbiology 2022Quote: ... In vitro transcripts were gel purified using 8 M urea 10% PAA and the ZR small-RNA PAGE Recovery Kit (Zymo Research). The in vitro transcribed RNAs carry three additional G nucleotides at their 5΄ ends originating from the T7 promoter ...
-
bioRxiv - Developmental Biology 2024Quote: Total RNA from 105 days old CorticOs (N = 4; n = 6-8 per genotype) was extracted using the Direct-zol RNA Miniprep Plus kit (Zymo Research) following the manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 0.2μL of 25mg/mL RNAse A (Zymo research #E1008-8) was used for each sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... or DNA/RNA Shield (Zymo Research; Cat: R1100-8-S) and stored at −80°C until further use.
-
bioRxiv - Microbiology 2023Quote: ... Controls samples included an 8-member positive controls (Zymo Research), as well as an extraction negative and a PCR negative controls ...
-
bioRxiv - Biophysics 2023Quote: ... 8 µL of 100T Zymolyases from Arthrobacter luteus (#E1004, Zymo Research, Irvine CA, USA) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA from rat lungs was isolated from the lysate using Direct-zol RNA MiniPrep (Zymo Research), according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... RNA was isolated from rat kidney samples and PTC cultures using Trizol + Direct-zol columns according to the referenced protocol (Zymo Research). For PTC cultures ...
-
bioRxiv - Microbiology 2020Quote: The Zymobiomics microbial community DNA standard consisting of 8 bacterial and 2 fungal genomic DNAs (cat. no. D6305) was obtained from Zymo Research (Irvine ...
-
bioRxiv - Microbiology 2020Quote: ... A mock community consisting of DNA extracted from of 8 bacterial species with known theoretical relative abundances (Zymo Research, USA) was included as positive control in sequencing library preparation ...
-
bioRxiv - Microbiology 2023Quote: ... Mosquito midguts that were dissected and oocyst-positive by microscopy at day 8 post-blood feeding were stored in either ethanol or DNA/RNA shield (Zymo Research) then subjected to DNAzol-based DNA extraction (Invitrogen) ...
-
bioRxiv - Systems Biology 2023Quote: ... Pools 4-8 from experimental replicate #2 were resuspended in 100 µL spheroplast digest buffer with 2.5U/mL Zymolyase T100 (Zymo Research #E1005) and incubated at 37°C for 20 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... and a mock microbial community DNA (8 bacterial + 2 yeasts species mixed in defined proportions) (ZymoBIOMICS Microbial Community DNA standard, Zymo Research, USA) were included in the experiments ...
-
bioRxiv - Microbiology 2020Quote: ... we prepared a series of 8 serial dilutions of a known mock microbial community consisting of 8 gram positive and negative bacteria and 2 yeast (Zymo Research, catalog # D6300), as previously described (31) ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... containing a known concentration and taxonomy of 8 bacterial and 2 fungal species was also included as an internal control (Zymo Research Corp, Cat No. D6310). Extracted nucleic acids from each sample were randomized into a 96-well rack (Figure 1C ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).