Labshake search
Citations for Zymo Research :
1 - 50 of 6045 citations for QuantiFluo Cholesterol Uptake Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The DNA from binding and uptake samples was purified using the Quick-DNA Microprep Plus Kit (Zymo research) and by following the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: Bisulfite conversion was performed using an Infinium HD Methylation Assay bisulfite conversion kit (EZ DNA Methylation Kit, Zymo Research, CA, USA). Bisulfite Converted DNA (BCD ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA for quantitative RT-PCR assays was isolated using the Quick-RNA Microprep kit (Zymo) with on-column DNase treatment per the manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... RNA isolation was performed using a Direct-zol RNA MicroPrep assay kit per manufactures instructions (ZYMO Research). Reverse transcription was carried out using PrimeScript RT Reagent Kit (TaKaRa ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was isolated separately for each fitness assay sample using a ZR Fungal/Bacterial DNA Kit (Zymo Research D6005) in individual 2.0 mL screw-cap tubes following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We performed DNA extractions from two 1.5 ml pellets for each assay-timepoint from our YPD 30°C fitness assays and from four 1.5 ml pellets from our SC 37°C fitness assays using Protocol I from the Yeastar Genomic DNA Kit (Zymo Research), as described previously (Johnson et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM CaCl2 or both chemicals for 16 h (see Plant materials, growth and stress assays) using the ZR Plant RNA MiniPrep Kit (Zymo Research). RNA sequencing was performed at The Mantoux Institute for Bioinformatics of the Nancy and Stephen Grand Israel National Center for Personalized Medicine ...
-
bioRxiv - Immunology 2023Quote: ... in sterile PBS for plaque assay or TRI Reagent (Zymo, #R2050-1) for gene expression analysis ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Genomic DNA extracted from whole fish following Fishbook assays were purified (Zymo Research) before PCR to remove PCR inhibitors in the fish tissues.
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Plant Biology 2023Quote: Yeast two-hybrid assays were performed as described in the Frozen-EZ Yeast Transformation II™ (Zymo Research). For the interaction of TaNF-YA3-D ...
-
bioRxiv - Genetics 2024Quote: Yeast two-hybrid assays were performed as described in the Frozen-EZ Yeast Transformation II™ (Zymo Research). The coding sequences of TabHLH27-A1 were cloned into the prey vector (pGADT7) ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2021Quote: ... the RCC kit (Zymo Research).
-
bioRxiv - Developmental Biology 2020Quote: ... or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNA purification kit (Zymo). cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo Research). For each transformation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli Transformation Kit (Zymo Research), and transformations were carried out using 50 ng of ligation product or plasmid ...
-
bioRxiv - Genetics 2023Quote: ... ZymoPure Midiprep Kit (Zymo Research) was used to prepare donor constructs for embryo injection ...
-
bioRxiv - Microbiology 2024Quote: ... Correct amplicons were isolated by Zymo PCR purification kit (Zymo Research). The PCR products were cloned into a PCR linearized pEcgRNA-guide plasmid to make the pEcgRNA-guide-RT plasmid using In-fusion® HD-cloning kit (Takara Bio ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli Transformation Kit (Zymo Research). Plasmids were prepared following standard protocols ...
-
bioRxiv - Biochemistry 2021Quote: ... Zyppy™ Plasmid Miniprep kit and DNA Clean & Concentrator™ kit were purchased from Zymo Research ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total RNA was isolated from using DNA/RNA Duet Kit miniprep kit (Zymo Research, USA).
-
bioRxiv - Genetics 2022Quote: ... cerevisiae temperature-sensitive strain TSA64 en masse using EZ Kit Yeast Transformation kit (Zymo Research). The entire transformed library was grown in selective media (YPD + clonNAT ...
-
bioRxiv - Genetics 2024Quote: ... cerevisiae double mutant strain sml1Δ rad53Δ using the EZ Kit Yeast Transformation kit (Zymo Research) to obtain ∼1,000,000 clones per region ...
-
bioRxiv - Synthetic Biology 2022Quote: ... whereas Zymoclean Gel DNA Recovery Kit and Zymoprep Yeast Plasmid Miniprep Kits were purchased from Zymo Research (Irvine ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted using a ‘Quick-DNA™’ Fungal/Bacterial 96 kit extraction kit (Zymo Research). A Nextera DNA library preparation kit (Illumina ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and Zymoclean Gel DNA Recovery Kit and Zymoprep Yeast Plasmid Miniprep Kits were purchased from Zymo Research (Irvine ...
-
bioRxiv - Neuroscience 2023Quote: ... and total RNA was isolated by using a commercial kit (RNA Clean & Concentrator kits, ZYMO Research). Total RNA (500 ng each ...
-
bioRxiv - Microbiology 2019Quote: ... YeaStar Genomic DNA kit (Zymo Research), and a protocol modified from Sergey Kryazhimskiy and Andrew Murray lab ...
-
bioRxiv - Synthetic Biology 2019Quote: ... using ZymoPURE Midi Kit (Zymo Research). CFPS reactions under oxidizing conditions conducive to disulfide bond formation were performed similarly to standard CFPS reactions except for the use of a 30 minute preincubation of the lysate with 14.3 µM IAM and the addition of 4 mM oxidized L-glutathione GSSG ...