Labshake search
Citations for Zymo Research :
1 - 50 of 6052 citations for QuantiChrom Protein Creatinine Ratio Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2022Quote: ... Libraries with low 260/230 ratios (< 1.8) or low concentration were re-purified using an RNA Clean and Concentrator kit (Zymo). RNA libraries were diluted to 20 ng μL−1 and reverse transcription was performed with an iScript cDNA synthesis kit (Bio-Rad) ...
-
bioRxiv - Genetics 2023Quote: ... The PCR products were then pooled at equimolar ratios and cleaned using the DNA Clean and Concentrator Kit (Zymo Research), followed by gel extraction ...
-
bioRxiv - Microbiology 2019Quote: ... The cells were harvested and the protein was purified using His-Spin Protein Miniprep kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: Bisulfite conversion was performed using an Infinium HD Methylation Assay bisulfite conversion kit (EZ DNA Methylation Kit, Zymo Research, CA, USA). Bisulfite Converted DNA (BCD ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA for quantitative RT-PCR assays was isolated using the Quick-RNA Microprep kit (Zymo) with on-column DNase treatment per the manufacturer’s protocol.
-
bioRxiv - Synthetic Biology 2022Quote: ... at a ratio of 1:3 (DNA : Zymo Shield / 20 µl DNA:60 µl Zymo Shield). O volume of 5µl of the PCR product was loaded on a gel for confirmation of the reaction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... at a ratio of 1:3 (DNA : Zymo Shield / 20 µl DNA:60 µl Zymo Shield). O volume of 5µl of the PCR product was loaded on a gel for confirmation of the reaction ...
-
bioRxiv - Immunology 2023Quote: ... RNA isolation was performed using a Direct-zol RNA MicroPrep assay kit per manufactures instructions (ZYMO Research). Reverse transcription was carried out using PrimeScript RT Reagent Kit (TaKaRa ...
-
bioRxiv - Immunology 2022Quote: pAd/S1RS09cg proteins were amplified and purified using ZymoPURE II plasmid maxiprep kit (Zymo Research). For Expi293 cell transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... and the DNAs were purified away from protein using a DNA Clean & Concentrator kit (Zymo Research). Both 5’ ends of 1 pmole of the CRISPR leader and array fragments were then labelled with 32P ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was isolated separately for each fitness assay sample using a ZR Fungal/Bacterial DNA Kit (Zymo Research D6005) in individual 2.0 mL screw-cap tubes following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We performed DNA extractions from two 1.5 ml pellets for each assay-timepoint from our YPD 30°C fitness assays and from four 1.5 ml pellets from our SC 37°C fitness assays using Protocol I from the Yeastar Genomic DNA Kit (Zymo Research), as described previously (Johnson et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM CaCl2 or both chemicals for 16 h (see Plant materials, growth and stress assays) using the ZR Plant RNA MiniPrep Kit (Zymo Research). RNA sequencing was performed at The Mantoux Institute for Bioinformatics of the Nancy and Stephen Grand Israel National Center for Personalized Medicine ...
-
bioRxiv - Neuroscience 2022Quote: ... Then the nucleic-acid bound protein isolation was performed using buffers from the Quick-RNA Miniprep Kit (Zymo Research) and the Zymo-Spin IIICG Column (Zymo Research) ...
-
bioRxiv - Cell Biology 2023Quote: ... Endogenous RNA cross-linked to bait protein was recovered from the beads using the QuickRNA Microprep Kit (Zymo Research). Complementary DNA was synthesized using the SuperScript III First-Strand Synthesis kit (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... DNA was captured on protein A/G agarose beads and purified using the ChIP DNA Clean & Concentrator kit (Zymo) and used for qPCR ...
-
bioRxiv - Microbiology 2020Quote: ... Combination of the two plasmids encoding the desired fusion proteins were transformed into Y2HGold cells using Frozen-EZ Yeast Transformation II Kit (Zymo Research). Selection for growth was carried out on selective drop-out plates lacking leucine and tryptophan (SD-Leu-Trp ...
-
bioRxiv - Plant Biology 2024Quote: ... was used to pull-down the protein/DNA complexes and DNA was purified using ChIP Clean-up and Concentrator kit (Zymo Research). Libraries were constructed using Ultra II DNA kit (NEB).
-
bioRxiv - Bioengineering 2022Quote: Yeast competent cells were transformed with polycistronic constructs containing fluorescent proteins using the Frozen-EZ yeast transformation II kit (Zymo Research, Irvine, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... then loaded directly onto a Ni-NTA protein miniprep column (His Spin Protein Miniprep, Zymo Research). Protein was washed following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... in sterile PBS for plaque assay or TRI Reagent (Zymo, #R2050-1) for gene expression analysis ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein degradation was performed by adding Proteinase K (Zymo) and Qiagen Protease (Qiagen) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Genomic DNA extracted from whole fish following Fishbook assays were purified (Zymo Research) before PCR to remove PCR inhibitors in the fish tissues.
-
bioRxiv - Cell Biology 2023Quote: ... ChIP-DNA was prepared using ZymoMag Protein A beads (Zymo Research). Input samples were also prepared using 10% of chromatin samples ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Plant Biology 2023Quote: Yeast two-hybrid assays were performed as described in the Frozen-EZ Yeast Transformation II™ (Zymo Research). For the interaction of TaNF-YA3-D ...
-
bioRxiv - Genetics 2024Quote: Yeast two-hybrid assays were performed as described in the Frozen-EZ Yeast Transformation II™ (Zymo Research). The coding sequences of TabHLH27-A1 were cloned into the prey vector (pGADT7) ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2021Quote: ... the RCC kit (Zymo Research).
-
bioRxiv - Developmental Biology 2020Quote: ... or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo Research). For each transformation ...