Labshake search
Citations for Zymo Research :
1 - 50 of 6051 citations for QuantiChrom Hyaluronidase Inhibitor Screening Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... All genomic DNA used for screening PCR was isolated using the Quick-DNA miniprep kit (Zymo Research). The resulting knockout strain was designated Variovorax CL14ΔHS33.
-
bioRxiv - Biophysics 2022Quote: ... Cells were scraped from each phenotyping plate after defined growth periods and genomic DNA was extracted from each screening plate with Yeastar Genomic DNA kit (Zymo) and amplified using emulsion PCR (EURx Micellula DNA Emulsion & Purification (ePCR ...
-
bioRxiv - Bioengineering 2019Quote: DNA associated with the mutants recovered from the fourth round of screening was isolated using a Zymoprep yeast plasmid miniprep II kit (Zymo Research). For both the TOM22 and c-Kit screens ...
-
bioRxiv - Microbiology 2023Quote: ... inhibitors were removed using the OneStep PCR Inhibitor Removal Kit (Zymo research; Catalog # D6035). These methods have been published in detail (36 ...
-
bioRxiv - Microbiology 2023Quote: ... Inhibitors were removed from the DNA extracts using the OneStep PCR Inhibitor Removal Kit (Zymo) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... Qiagen DNeasy Blood and Tissue Kit and post-extraction inhibitor removal with the Zymo Research OneStep™ PCR Inhibitor Removal Kit (QBT-ZYMO), 4 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and potential PCR inhibitors were removed with the OneStep-96TM PCR Inhibitor Removal Kit (Zymo Research). RNA concentrations were quantified with the Qubit RNA Assay kit (Life Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... and Zymo OneStep PCR Inhibitor Removal Kit (D6030, Zymo) to obtain high quality genomic DNA ...
-
bioRxiv - Microbiology 2021Quote: ... PCR inhibitors were then removed from the extracted DNA using the OneStep PCR inhibitor removal kit (Zymo) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... the OneStep PCR inhibitor removal kit (Zymo Research, Irvine, CA, USA) was employed ...
-
bioRxiv - Genetics 2023Quote: ... treated with the Zymo PCR Inhibitor Removal kit (Zymo Research, Irvine CA) to remove melanin ...
-
bioRxiv - Genomics 2024Quote: ... followed by cleanup with the OneStep PCR Inhibitor Removal Kit (Zymo Research). qPCR quantification was carried out in duplicate for each replicate with primers PrymF2239 (5’-CACATCCGATCGTGTCTGC-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was cleaned using the OneStep™ PCR inhibitor removal kit (Zymo Research) prior to being used in quantitative PCR (qPCR) ...
-
bioRxiv - Genetics 2019Quote: Zymo OneStep™ PCR Inhibitor Removal Kit (Zymo Research; Cat No./ID: D6030) was used following the manufacturer’s protocol in order to remove any carryover PCR inhibitors from previous steps ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was purified with the OneStep™ PCR Inhibitor Removal Kit (Zymo Research, USA) and diluted 1:5 ...
-
bioRxiv - Microbiology 2019Quote: ... Zymo Onestep Inhibitor Removal kit was then performed following manufacturers instructions (Zymo Research PN. D6035). DNA samples were then quantified using Quant-iT on an Eppendorf AF2200 plate reader.
-
bioRxiv - Microbiology 2020Quote: ... Extractions were then purified with the OneStep PCR Inhibitor Removal Kit (Zymo Research, CA, USA).
-
bioRxiv - Microbiology 2020Quote: ... #12 DNA were purified using the OneStep PCR Inhibitor Removal Kit (Zymo Research, CA, USA). Then ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was purified prior to PCR using the Zymo OneStep PCR Inhibitor Removal Kit (Zymo), per the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Melanin was removed from genomic DNA using the OneStepTM PCR Inhibitor Removal kit (Zymo Research). Genomic DNA was measured by Nanodrop and diluted to ∼20ng/µl ...
-
bioRxiv - Molecular Biology 2022Quote: Bisulfite conversion was performed using an Infinium HD Methylation Assay bisulfite conversion kit (EZ DNA Methylation Kit, Zymo Research, CA, USA). Bisulfite Converted DNA (BCD ...
-
bioRxiv - Microbiology 2021Quote: ... Eluted sample was cleaned-up using the OneStep PCR Inhibitor Removal Kit (Zymo Research, Irvine, California), and DNA was quantified using a Quantus Fluorometer (Promega Corporation ...
-
bioRxiv - Genetics 2020Quote: ... gDNA was purified prior to PCR using the Zymo OneStep PCR Inhibitor Removal Kit (Zymo, D6030), per the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... and further cleaned up by a OneStep PCR Inhibitor Removal Kit (D6030; Zymo Research, Irvine, CA) before PCR amplification ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA for quantitative RT-PCR assays was isolated using the Quick-RNA Microprep kit (Zymo) with on-column DNase treatment per the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2021Quote: ... High melanin content was removed with OneStep™ PCR Inhibitor Removal Kit (Zymo Research Corporation, Irvine, CA). Direct-zol™ RNA MiniPrep w/ Zymo-Spin™ IIC Columns (Zymo cat # D4019 ...
-
bioRxiv - Microbiology 2020Quote: ... Extracted DNA was purified using a OneStep™ PCR Inhibitor Removal kit (Zymo Research, Irvine, CA, USA) and subsequently quantified using an Qubit dsDNA HS assay (Thermo-Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... RNA isolation was performed using a Direct-zol RNA MicroPrep assay kit per manufactures instructions (ZYMO Research). Reverse transcription was carried out using PrimeScript RT Reagent Kit (TaKaRa ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was prepared by using ISOGEN (Nippon Gene, Japan) and PCR Inhibitor Removal Kit (Zymo Research, USA). The RNA was reverse transcribed to cDNA by using Superscript III Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was isolated separately for each fitness assay sample using a ZR Fungal/Bacterial DNA Kit (Zymo Research D6005) in individual 2.0 mL screw-cap tubes following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... DNA was eluted in 105 µL RNAse free H2O and was further cleaned using OneStep PCR Inhibitor Removal Kit (Zymo Research). Concentrations for all DNA samples were measured using Qubit 3.0 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We performed DNA extractions from two 1.5 ml pellets for each assay-timepoint from our YPD 30°C fitness assays and from four 1.5 ml pellets from our SC 37°C fitness assays using Protocol I from the Yeastar Genomic DNA Kit (Zymo Research), as described previously (Johnson et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM CaCl2 or both chemicals for 16 h (see Plant materials, growth and stress assays) using the ZR Plant RNA MiniPrep Kit (Zymo Research). RNA sequencing was performed at The Mantoux Institute for Bioinformatics of the Nancy and Stephen Grand Israel National Center for Personalized Medicine ...
-
bioRxiv - Microbiology 2021Quote: ... Isolated gDNAs were further prepared and cleaned up using a OneStep™ PCR Inhibitor Removal Kit according to manufacturer instructions (Zymo Research, D6030).
-
bioRxiv - Microbiology 2020Quote: ... the nucleic acids were resuspended in DEPC-treated nuclease-free water purified with the OneStep PCR Inhibitor Removal Kit (Zymo Research, Irvine, USA), then split into a fraction for DNA and one for RNA ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from the solid and liquid aliquots using the Qiagen AllPrep PowerViral DNA/RNA kit and further purified using the Zymo OneStep PCR inhibitor removal columns (Zymo Research, Irvine, CA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli genomic DNA without sedimentary DNA extract) were considered inhibited and were subsequently purified using the One-Step Inhibitor Removal kit (Zymo Research Europe, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... DNA was eluted in 60 μl elution buffer and further purified by using the OneStep PCR Inhibitor Removal Kit (ZymoBIOMICS, Zymo Research, Irvine, CA, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... PCR inhibitors were removed from the resulting gDNA (Zymo Research, D6030) and the concentration of the resulting gDNA was measured using the Qubit dsDNA HS assay kit (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: ... Eluted DNA was treated with Zymo OneStep PCR Inhibitor Removal columns (Zymo Research). Extractions were performed in a UV-sterilized laminar flow hood and all extraction instruments and bench spaces were sterilized with a 10% bleach solution or UV light ...
-
bioRxiv - Genomics 2021Quote: ... Eluted DNA was treated with Zymo OneStep PCR Inhibitor Removal columns (Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... in sterile PBS for plaque assay or TRI Reagent (Zymo, #R2050-1) for gene expression analysis ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Genomic DNA extracted from whole fish following Fishbook assays were purified (Zymo Research) before PCR to remove PCR inhibitors in the fish tissues.
-
bioRxiv - Plant Biology 2019Quote: ... the DNA samples were placed through Zymo OneStep PCR inhibitor removal columns (Zymo, Irvine, CA) to remove any secondary metabolites that might inhibit PCR amplification ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Extracted DNA was run through a Zymo OneStep PCR Inhibitor Removal Column (Zymo, Irvine, CA) twice.
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Microbiology 2022Quote: ... These crude extracts were subsequently purified by passage through a OneStep PCR Inhibitor Removal column (Zymo, D6030) and purity was assessed by UV-spectra ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...