Labshake search
Citations for Zymo Research :
1 - 50 of 6060 citations for QuantiChrom β N Acetylglucosaminidase Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... The Methylated-DNA IP Kit from Zymo (Cat. N° D5101) was applied according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: Total RNA from 105 days old CorticOs (N = 4; n = 6-8 per genotype) was extracted using the Direct-zol RNA Miniprep Plus kit (Zymo Research) following the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... genomic DNA and RNA were extracted from fresh frozen tumor (n=2) and normal (n=3) samples using the ZR-Duet DNA/RNA MiniPrep extraction kit (ZYMO RESEARCH, Irvine, CA). Quantification was performed with a NanoDrop One™ spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: DNA from the meconium samples (N = 25) and corresponding negative controls (N = 11) were extracted using ZymoBIOMICS DNA Miniprep Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Bisulfite conversion was performed using the EZ DNA Methylation-Gold kit (Zymo Research, Cat. N: D5005) followed by library construction using the Accel-NGS® Methyl-Seq DNA Library kit (Swift Bioscience ...
-
bioRxiv - Genetics 2024Quote: CO (n=3) were pooled together for RNA extraction using Quick-RNA Miniprep Kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... and KI-TTL mice (N=3 per group) using the Direct-zol RNA Microprep Kit (Zymo Research) followed by a DNase digestion step ...
-
bioRxiv - Microbiology 2023Quote: ... control samples (n = 4, one for each extraction batch) using commercially available kits optimized for fecal-based microbial communities (Zymo fecal/soil kit), and some aliquots archived ...
-
bioRxiv - Microbiology 2023Quote: ... and WC (anaerobic: n = 131) isolates using the Quick-DNA Fungal/Bacterial Miniprep Kit (Zymo Research, Irvine, CA, USA) according to manufacturer’s instructions with the modifications outlined in our previous publication (Webb et al. ...
-
bioRxiv - Genetics 2021Quote: ... we dissected embryonic tails at E12.5 (n = 4) and E14.5 (n = 4) and extracted RNA using 50 µl Direct-zol (Zymo Research) following the manufacturer’s protocol and used the same library preparation procedures as for the parental samples ...
-
bioRxiv - Immunology 2020Quote: ... Cloning and sequencing of the full ORF cDNA of AgPGE2R was performed from total RNA isolated from hemocytes perfused from non-blood fed female mosquitoes (n=50) using Direct-zol RNA Miniprep kit (Zymo research). After DNase I treatment following manufacture’s protocol (New England Biolabs) ...
-
bioRxiv - Physiology 2020Quote: Total RNA was extracted from late third instar fat bodies (n = 4-6 pooled/sample) using a Direct-zol RNA MicroPrep kit (Zymo Research). DNAse-treated total RNA (1 µg ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from rosette tissue harvested at ZT 23 on day 25 post imbibition (n = 4 biological replicates) using the Direct-zol-96 MagBead RNA kit (Zymo Research). RNA was checked for degradation using a Tapestation 4150 (Agilent ...
-
bioRxiv - Molecular Biology 2022Quote: Bisulfite conversion was performed using an Infinium HD Methylation Assay bisulfite conversion kit (EZ DNA Methylation Kit, Zymo Research, CA, USA). Bisulfite Converted DNA (BCD ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA for quantitative RT-PCR assays was isolated using the Quick-RNA Microprep kit (Zymo) with on-column DNase treatment per the manufacturer’s protocol.
-
bioRxiv - Physiology 2020Quote: ... from all the experimental groups (n=3/group) was subjected to bisulphite treatment using the EZ DNA methylation™ kit (Zymo Research, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... RNA isolation was performed using a Direct-zol RNA MicroPrep assay kit per manufactures instructions (ZYMO Research). Reverse transcription was carried out using PrimeScript RT Reagent Kit (TaKaRa ...
-
bioRxiv - Genomics 2020Quote: ... flash frozen in liquid nitrogen and stored at -80 °C for further usage or RNA was extracted using the Quick-RNA FFPE Miniprep kit (Zymo Research, Cat. N: R1008) with Zymo-Spin IC Columns (Zymo Research ...
-
bioRxiv - Genomics 2020Quote: ... with Zymo-Spin IC Columns (Zymo Research, Cat. N: C1004-250).
-
bioRxiv - Genomics 2020Quote: ... sheared and biotinylated fully methylated pUC19 (Zymo Research, Cat. N: D5017) and unmethylated lambda DNA (Promega ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was isolated separately for each fitness assay sample using a ZR Fungal/Bacterial DNA Kit (Zymo Research D6005) in individual 2.0 mL screw-cap tubes following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... We transformed infusion reactions into Mix N’ Go (Zymo Research catalog # T3001) chemically competent Stbl3 E ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We performed DNA extractions from two 1.5 ml pellets for each assay-timepoint from our YPD 30°C fitness assays and from four 1.5 ml pellets from our SC 37°C fitness assays using Protocol I from the Yeastar Genomic DNA Kit (Zymo Research), as described previously (Johnson et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM CaCl2 or both chemicals for 16 h (see Plant materials, growth and stress assays) using the ZR Plant RNA MiniPrep Kit (Zymo Research). RNA sequencing was performed at The Mantoux Institute for Bioinformatics of the Nancy and Stephen Grand Israel National Center for Personalized Medicine ...
-
bioRxiv - Genetics 2021Quote: ... Pricked flies were placed into a spin column (Zymo Research, Cat. N. C1005-50) with plastic ring and filling removed (leaving only bottom glass wool layer) ...
-
bioRxiv - Genomics 2020Quote: ... pH 7.4) in the presence of 0.1% β-mercaptoethanol and 25 Units of Zymolase (Zymo Research). Spheroblasts were lysed by centrifugation in Qiashredder columns and total RNA was isolated using the RNEasy Mini Plus kit (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Circular RNA was purified through RNA Clean & Concentrator(tm)-5 column (Zymo research, Cat. n° R1013) and quantified using Qubit(tm ...
-
bioRxiv - Cell Biology 2021Quote: ... Spheroplasting of harvested yeast cells was performed for 2 minutes in lysis buffer (1 M sorbitol 100 mM EDTA, 0.1% β-mercaptoethanol) containing 25 units of zymolyase (Zymo Research). RNA extraction was performed with an RNeasy kit (QIAGEN ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA fragments were purified from the reaction using a RNA Clean & Concentrator(tm)-5 column (Zymo Research, Cat. n° R1013). The resulting RNA fragments were ligated to different adaptors (listed in Supplementary Table 1 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were pretreated with a solution of β-mercaptoethanol plus 60 mM EDTA and then incubated with 6 U/mL zymolyase (Zymo Research) in Buffer I to remove the cell wall ...
-
bioRxiv - Genomics 2019Quote: ... DNA and RNA from young and old animals (n=6/group) was isolated from hippocampal tissue using Zymo Duet DNA/RNA (Zymo research).
-
bioRxiv - Plant Biology 2022Quote: ... DNA extracted from NIa-N and PR leaves were treated with bisulfite (EZ DNA methylation gold, Zymo Research, Orange, CA, USA) before PCR amplification of the 35S promoter region of the CaMV ...
-
bioRxiv - Immunology 2023Quote: ... in sterile PBS for plaque assay or TRI Reagent (Zymo, #R2050-1) for gene expression analysis ...
-
bioRxiv - Microbiology 2020Quote: ... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
bioRxiv - Biophysics 2023Quote: ... The reactions were quenched with β-mercaptoethanol (50% by volume) followed by column purification (Oligo Clean & Concentrator, Zymo Research #D4060, here and below). The adenylated 18 nt unique molecular indicator (UMI ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Genomic DNA extracted from whole fish following Fishbook assays were purified (Zymo Research) before PCR to remove PCR inhibitors in the fish tissues.
-
bioRxiv - Microbiology 2021Quote: ... Samples were diluted in carbon free N−C− minimal medium and spread on LB agar plates using Rattler Plating Beads (Zymo Research, Irvine, CA, USA) with a target density of 200 colonies per plate ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...