Labshake search
Citations for Zymo Research :
1 - 50 of 6056 citations for Mouse Melanocyte Stimulating Hormone Receptor MC1R ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from 1×106 primary melanocytes (MC) using an RNA isolation kit (Zymo Research) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... was used for the estimation of global 5-hmC and 5-mC levels by ELISA using the Quest 5-hmC ELISA kit and the 5-mC DNA ELISA kit (Zymo research Inc, USA) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... measured with the 5mC ELISA kit (Zymo Research), to 12 % of the total human 5-methylated cytosine (5mC ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ...
-
bioRxiv - Genetics 2022Quote: ... cells were synchronized in G1 phase by addition of 4 µg/mL α-factor (Zymo research, mating hormone peptide) for 2 h ...
-
bioRxiv - Neuroscience 2023Quote: Genome-wide DNA methylation levels were determined using the 5-mC DNA ELISA Kit (Zymo Research, D5325) per the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: Global DNA methylation was performed in genomic DNA using 5-mC DNA ELISA kit (Zymo Research, USA) following manufacturer’s protocol and that described in (Valdivieso et al. ...
-
bioRxiv - Zoology 2024Quote: ... These amplified products were then purified as above and restriction enzyme digested CCHa1R and CCHa2R sequences were ligated into pcDNA3.1+ and pBudCE4.1 mammalian expression vectors followed by bacterial transformation and plasmid DNA purification to obtain a large quantity of receptor constructs using ZymoPURE II Plasmid Midiprep Kit (Zymo Research, Tustin, CA, USA) following the manufacturer recommendation ...
-
bioRxiv - Plant Biology 2023Quote: ... Relative quantification of 5-methylcytosine (5-mC) over time was determined using the 5-mC DNA ELISA Kit (Zymo Research), using 100 ng of genomic DNA per sample as input ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA samples were also used for global DNA methylation analysis using the 5-mC DNA ELISA Kit (Zymo Research, Irvine, CA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... and primary mouse keratinocytes was isolated using Direct-zol RNA Microprep Kits (Zymo) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: RNA from mouse lungs was extracted using RNA Miniprep Plus Kit (Zymo Research). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: gDNA was isolated from mouse gastrocnemius using Quick-DNA Microprep Plus Kit (Zymo D4074). gDNA was amplified using CloneAmp™ HiFi PCR Premix (Takara 639298 ...
-
bioRxiv - Cell Biology 2022Quote: ... and total RNA of mouse organoids was isolated using Quick-RNA Miniprep Plus Kit (Zymo Research), and all of them were assessed for purity and quantity using a Nanodrop 1000 spectrophotometer ...
-
bioRxiv - Molecular Biology 2021Quote: ... pLXSP-16E7 or control vector infected primary mouse keratinocytes with the Quick-RNA Miniprep kit (Zymo Research). cDNA was synthesized with the Quantinova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from mouse hearts using either the Direct-zol RNA Miniprep kit (Zymo, cat# R2051) or the RNeasy Fibrous Tissue Mini Kit (QIAGEN ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from mouse hippocampus with the Quick-RNA Miniprep Plus Kit (Zymo Research, R1058) and RNA integrity was determined using Agilent Bioanalyzer ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA (400 ng) from mouse tail was bisulphite converted with the EZ DNA Methylation-Lightning kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was prepared from fibroblasts isolated from mouse hearts using Direct-zol RNA miniprep kit (Zymo Research). cDNA libraries were prepared using the NEBNext Ultra Directional Library Preparation Kit following rRNA depletion using the NEB rRNA depletion kit ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse back skin was homogenized and RNA was extracted using Quick-RNA Miniprep Kit (Zymo Research, Cat# R1054) per the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Total RNA was extracted from mouse tissues and HEK293 cells using Quick-RNA MiniPrep Kit (ZYMO Research, Irvine, CA). Five μg of treated RNA was used as template for first-strand cDNA synthesis by using RevertAid RT Reverse Transcription Kit (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: RNA was isolated from mouse iBAT following the standard protocol for the Direct-zol RNA Miniprep kit (Zymo Research) and assessed for quality on the Agilent 2200 TapeStation (Agilent Technologies) ...
-
bioRxiv - Systems Biology 2022Quote: Total RNA was extracted from mouse kidneys and livers by the Direct-zol™ RNA Purification Kits (Zymo Research). Purified RNA was reverse transcribed using the SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4sU-labelled mouse and Drosophila cells were mixed and RNA was extracted using the Direct-zol DNA/RNA Miniprep kit (Zymo Research) as per the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... genomic DNA was isolated from a small aliquot of mixed mouse and fly cells using Quick-DNA Miniprep kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from human iPSC-FBs and mouse Raw 264-7 cells using the Direct-Zol RNA kit (Zymo Research) according to manufacturer instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... Total RNA was then isolated from all mouse tissues using TRIzol reagent and RNA Isolation kits with on-column DNase treatment (Zymo Cat# R2072). cDNA synthesis was performed with random primers from the Protoscript cDNA synthesis kit (NEB Cat#E6560S) ...
-
bioRxiv - Developmental Biology 2021Quote: ... or Universal Methylated Mouse DNA Standard (Zymo Research) was bisulfite converted using EZ DNA Methylation-GoldTM Kit (Zymo Research) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Universally methylated mouse DNA standard (cat. no. D5012, Zymo Research) and Mlh1−/− tissues were used as Mlh1+/+ and Mlh1−/− allele controls ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Molecular Biology 2020Quote: ... Universally methylated mouse DNA standard (cat. no. D5012, Zymo Research, Irvine, CA) and genomic DNA extracted from normal spleen was used as positive and negative controls ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).