Labshake search
Citations for Zymo Research :
1 - 50 of 6061 citations for Mouse Meiotic Recombination Protein REC8 Homolog REC8 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Sixty homologous recombination reaction systems were prepared and DNA purification kit (ZYMO ; d4013), and the purified product was transformed into Thermo Fisher Scientific (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... was used for the estimation of global 5-hmC and 5-mC levels by ELISA using the Quest 5-hmC ELISA kit and the 5-mC DNA ELISA kit (Zymo research Inc, USA) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... measured with the 5mC ELISA kit (Zymo Research), to 12 % of the total human 5-methylated cytosine (5mC ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ...
-
bioRxiv - Neuroscience 2023Quote: Genome-wide DNA methylation levels were determined using the 5-mC DNA ELISA Kit (Zymo Research, D5325) per the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: Global DNA methylation was performed in genomic DNA using 5-mC DNA ELISA kit (Zymo Research, USA) following manufacturer’s protocol and that described in (Valdivieso et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... Relative quantification of 5-methylcytosine (5-mC) over time was determined using the 5-mC DNA ELISA Kit (Zymo Research), using 100 ng of genomic DNA per sample as input ...
-
bioRxiv - Microbiology 2019Quote: ... The cells were harvested and the protein was purified using His-Spin Protein Miniprep kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: Wild type 4D5 and 5A12 VH and VL scFv gene fragments were purchased from Twist Bioscience and transformed into the BamHI digested pYD1 plasmid via homologous recombination (Boder and Wittrup, 1997; Chao et al., 2006) using Frozen-EZ Yeast Transformation II (Zymo Research, T2001). 4D5 scFv was transformed in a HA-VL-218-VH-FLAG orientation and 5A12 scFv as HA-VH-218-VL-FLAG ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA samples were also used for global DNA methylation analysis using the 5-mC DNA ELISA Kit (Zymo Research, Irvine, CA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... and primary mouse keratinocytes was isolated using Direct-zol RNA Microprep Kits (Zymo) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: RNA from mouse lungs was extracted using RNA Miniprep Plus Kit (Zymo Research). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: gDNA was isolated from mouse gastrocnemius using Quick-DNA Microprep Plus Kit (Zymo D4074). gDNA was amplified using CloneAmp™ HiFi PCR Premix (Takara 639298 ...
-
bioRxiv - Immunology 2022Quote: pAd/S1RS09cg proteins were amplified and purified using ZymoPURE II plasmid maxiprep kit (Zymo Research). For Expi293 cell transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... and the DNAs were purified away from protein using a DNA Clean & Concentrator kit (Zymo Research). Both 5’ ends of 1 pmole of the CRISPR leader and array fragments were then labelled with 32P ...
-
bioRxiv - Cell Biology 2022Quote: ... and total RNA of mouse organoids was isolated using Quick-RNA Miniprep Plus Kit (Zymo Research), and all of them were assessed for purity and quantity using a Nanodrop 1000 spectrophotometer ...
-
bioRxiv - Molecular Biology 2021Quote: ... pLXSP-16E7 or control vector infected primary mouse keratinocytes with the Quick-RNA Miniprep kit (Zymo Research). cDNA was synthesized with the Quantinova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from mouse hearts using either the Direct-zol RNA Miniprep kit (Zymo, cat# R2051) or the RNeasy Fibrous Tissue Mini Kit (QIAGEN ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from mouse hippocampus with the Quick-RNA Miniprep Plus Kit (Zymo Research, R1058) and RNA integrity was determined using Agilent Bioanalyzer ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA (400 ng) from mouse tail was bisulphite converted with the EZ DNA Methylation-Lightning kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was prepared from fibroblasts isolated from mouse hearts using Direct-zol RNA miniprep kit (Zymo Research). cDNA libraries were prepared using the NEBNext Ultra Directional Library Preparation Kit following rRNA depletion using the NEB rRNA depletion kit ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse back skin was homogenized and RNA was extracted using Quick-RNA Miniprep Kit (Zymo Research, Cat# R1054) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Then the nucleic-acid bound protein isolation was performed using buffers from the Quick-RNA Miniprep Kit (Zymo Research) and the Zymo-Spin IIICG Column (Zymo Research) ...
-
bioRxiv - Cell Biology 2023Quote: ... Endogenous RNA cross-linked to bait protein was recovered from the beads using the QuickRNA Microprep Kit (Zymo Research). Complementary DNA was synthesized using the SuperScript III First-Strand Synthesis kit (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... DNA was captured on protein A/G agarose beads and purified using the ChIP DNA Clean & Concentrator kit (Zymo) and used for qPCR ...
-
bioRxiv - Bioengineering 2020Quote: ... Total RNA was extracted from mouse tissues and HEK293 cells using Quick-RNA MiniPrep Kit (ZYMO Research, Irvine, CA). Five μg of treated RNA was used as template for first-strand cDNA synthesis by using RevertAid RT Reverse Transcription Kit (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: RNA was isolated from mouse iBAT following the standard protocol for the Direct-zol RNA Miniprep kit (Zymo Research) and assessed for quality on the Agilent 2200 TapeStation (Agilent Technologies) ...
-
bioRxiv - Systems Biology 2022Quote: Total RNA was extracted from mouse kidneys and livers by the Direct-zol™ RNA Purification Kits (Zymo Research). Purified RNA was reverse transcribed using the SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Combination of the two plasmids encoding the desired fusion proteins were transformed into Y2HGold cells using Frozen-EZ Yeast Transformation II Kit (Zymo Research). Selection for growth was carried out on selective drop-out plates lacking leucine and tryptophan (SD-Leu-Trp ...
-
bioRxiv - Plant Biology 2024Quote: ... was used to pull-down the protein/DNA complexes and DNA was purified using ChIP Clean-up and Concentrator kit (Zymo Research). Libraries were constructed using Ultra II DNA kit (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... 4sU-labelled mouse and Drosophila cells were mixed and RNA was extracted using the Direct-zol DNA/RNA Miniprep kit (Zymo Research) as per the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... genomic DNA was isolated from a small aliquot of mixed mouse and fly cells using Quick-DNA Miniprep kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from human iPSC-FBs and mouse Raw 264-7 cells using the Direct-Zol RNA kit (Zymo Research) according to manufacturer instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... Total RNA was then isolated from all mouse tissues using TRIzol reagent and RNA Isolation kits with on-column DNase treatment (Zymo Cat# R2072). cDNA synthesis was performed with random primers from the Protoscript cDNA synthesis kit (NEB Cat#E6560S) ...
-
bioRxiv - Bioengineering 2022Quote: Yeast competent cells were transformed with polycistronic constructs containing fluorescent proteins using the Frozen-EZ yeast transformation II kit (Zymo Research, Irvine, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... then loaded directly onto a Ni-NTA protein miniprep column (His Spin Protein Miniprep, Zymo Research). Protein was washed following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... or Universal Methylated Mouse DNA Standard (Zymo Research) was bisulfite converted using EZ DNA Methylation-GoldTM Kit (Zymo Research) ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein degradation was performed by adding Proteinase K (Zymo) and Qiagen Protease (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Universally methylated mouse DNA standard (cat. no. D5012, Zymo Research) and Mlh1−/− tissues were used as Mlh1+/+ and Mlh1−/− allele controls ...
-
bioRxiv - Cell Biology 2023Quote: ... ChIP-DNA was prepared using ZymoMag Protein A beads (Zymo Research). Input samples were also prepared using 10% of chromatin samples ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Molecular Biology 2020Quote: ... Universally methylated mouse DNA standard (cat. no. D5012, Zymo Research, Irvine, CA) and genomic DNA extracted from normal spleen was used as positive and negative controls ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).