Labshake search
Citations for Zymo Research :
1 - 50 of 6066 citations for Mouse IL 12 p40 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... was used for the estimation of global 5-hmC and 5-mC levels by ELISA using the Quest 5-hmC ELISA kit and the 5-mC DNA ELISA kit (Zymo research Inc, USA) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... measured with the 5mC ELISA kit (Zymo Research), to 12 % of the total human 5-methylated cytosine (5mC ...
-
bioRxiv - Genomics 2023Quote: ... At least four million IL-1βlow and IL-1βhigh cells were collected for genomic DNA extraction using Quick-DNA FFPE Kit (Zymo Research). PCR reactions containing up to 10 μg genomic DNA in each reaction were performed using ExTaq DNA Polymerase with primers to amplify the sgRNAs ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ...
-
bioRxiv - Neuroscience 2023Quote: Genome-wide DNA methylation levels were determined using the 5-mC DNA ELISA Kit (Zymo Research, D5325) per the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: Global DNA methylation was performed in genomic DNA using 5-mC DNA ELISA kit (Zymo Research, USA) following manufacturer’s protocol and that described in (Valdivieso et al. ...
-
bioRxiv - Microbiology 2020Quote: ... #12 DNA were purified using the OneStep PCR Inhibitor Removal Kit (Zymo Research, CA, USA). Then ...
-
bioRxiv - Plant Biology 2023Quote: ... Relative quantification of 5-methylcytosine (5-mC) over time was determined using the 5-mC DNA ELISA Kit (Zymo Research), using 100 ng of genomic DNA per sample as input ...
-
bioRxiv - Cancer Biology 2019Quote: ... This reaction was purified and concentrated in 12 μl water using the DNA Clean & Concentrator™ kit (Zymo, #D4033) and transformed into electrocompetent SURE 2 cells (Agilent ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA samples were also used for global DNA methylation analysis using the 5-mC DNA ELISA Kit (Zymo Research, Irvine, CA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: RNA was isolated from mid-log phase protists grown at normal growth temperature or 12°C using the Direct-zol RNA Miniprep kit (Zymo). RNA libraries were generated using the KAPA Stranded mRNA Sequencing Kit (Roche) ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA from either CD34+ cells sorted after transduction or bulk cells at day 12 of culture was extracted using Direct-Zol RNA MicroPrep Kit (Zymo Research) and reverse transcription was performed with SuperScript Vilo cDNA Synthesis Kit (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... total RNA from biological triplicates of HMLE-Twist and HMLE-pBp cells was extracted (12 biological samples in total) with Quick-RNA Miniprep kit (Zymo Research) according to manufacturer protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... and primary mouse keratinocytes was isolated using Direct-zol RNA Microprep Kits (Zymo) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: RNA from mouse lungs was extracted using RNA Miniprep Plus Kit (Zymo Research). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... the supernatant was reverse-crosslinked overnight (12-16 hours) at 65°C prior to ChIP DNA isolation using Zymogen ChIP DNA Clean and Concentrator Kit (Zymo Research, D5205). For ChIP-seq ...
-
bioRxiv - Neuroscience 2023Quote: Primary cortical neurons were infected at 3 DIV with FL1 and at 10-12 DIV neurons were harvested and DNA extracted using Quick-DNA Miniprep Kit (Zymo Research, USA) following manufacturer recommendations ...
-
bioRxiv - Cell Biology 2023Quote: gDNA was isolated from mouse gastrocnemius using Quick-DNA Microprep Plus Kit (Zymo D4074). gDNA was amplified using CloneAmp™ HiFi PCR Premix (Takara 639298 ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from the subset of 12 samples utilized for metagenomics using the Zymobiomics DNA/RNA Mini Kit (Zymo Research, CA, USA) and RNA was cleaned ...
-
bioRxiv - Genetics 2020Quote: ... then eluted using 12 μl of elution buffer (Zymo Research). Bisulfite-converted DNA (4 μl ...
-
bioRxiv - Cell Biology 2022Quote: ... and total RNA of mouse organoids was isolated using Quick-RNA Miniprep Plus Kit (Zymo Research), and all of them were assessed for purity and quantity using a Nanodrop 1000 spectrophotometer ...
-
bioRxiv - Molecular Biology 2021Quote: ... pLXSP-16E7 or control vector infected primary mouse keratinocytes with the Quick-RNA Miniprep kit (Zymo Research). cDNA was synthesized with the Quantinova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from mouse hearts using either the Direct-zol RNA Miniprep kit (Zymo, cat# R2051) or the RNeasy Fibrous Tissue Mini Kit (QIAGEN ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from mouse hippocampus with the Quick-RNA Miniprep Plus Kit (Zymo Research, R1058) and RNA integrity was determined using Agilent Bioanalyzer ...
-
bioRxiv - Genomics 2019Quote: ... The reaction was stopped by adding 12 μL DNA binding buffer (Zymo) and incubating at room temperature for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA (400 ng) from mouse tail was bisulphite converted with the EZ DNA Methylation-Lightning kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was prepared from fibroblasts isolated from mouse hearts using Direct-zol RNA miniprep kit (Zymo Research). cDNA libraries were prepared using the NEBNext Ultra Directional Library Preparation Kit following rRNA depletion using the NEB rRNA depletion kit ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse back skin was homogenized and RNA was extracted using Quick-RNA Miniprep Kit (Zymo Research, Cat# R1054) per the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Total RNA was extracted from mouse tissues and HEK293 cells using Quick-RNA MiniPrep Kit (ZYMO Research, Irvine, CA). Five μg of treated RNA was used as template for first-strand cDNA synthesis by using RevertAid RT Reverse Transcription Kit (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: RNA was isolated from mouse iBAT following the standard protocol for the Direct-zol RNA Miniprep kit (Zymo Research) and assessed for quality on the Agilent 2200 TapeStation (Agilent Technologies) ...
-
bioRxiv - Systems Biology 2022Quote: Total RNA was extracted from mouse kidneys and livers by the Direct-zol™ RNA Purification Kits (Zymo Research). Purified RNA was reverse transcribed using the SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reaction was terminated by addition of 12 μL of DNA binding buffer (Zymo) and incubated for 5 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 μL CircLigase) for 12 hours at 60°C and subsequently purified by Zymo RNA Clean & Concentrator 5 columns (100 μL sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4sU-labelled mouse and Drosophila cells were mixed and RNA was extracted using the Direct-zol DNA/RNA Miniprep kit (Zymo Research) as per the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... genomic DNA was isolated from a small aliquot of mixed mouse and fly cells using Quick-DNA Miniprep kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from human iPSC-FBs and mouse Raw 264-7 cells using the Direct-Zol RNA kit (Zymo Research) according to manufacturer instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... Total RNA was then isolated from all mouse tissues using TRIzol reagent and RNA Isolation kits with on-column DNase treatment (Zymo Cat# R2072). cDNA synthesis was performed with random primers from the Protoscript cDNA synthesis kit (NEB Cat#E6560S) ...
-
bioRxiv - Neuroscience 2023Quote: ... The reaction was stopped with 12 uL of DNA binding buffer (Zymo Research, D4004-1-L). Ampure-based bead purification ...
-
bioRxiv - Microbiology 2023Quote: ... The 60 samples were pooled into 5 groups of 12 samples each during purification using RNA Clean & Concentrator (Zymo Research) and all eluted with 16µl DEPC UltraPure water.
-
bioRxiv - Developmental Biology 2021Quote: ... or Universal Methylated Mouse DNA Standard (Zymo Research) was bisulfite converted using EZ DNA Methylation-GoldTM Kit (Zymo Research) ...
-
bioRxiv - Microbiology 2020Quote: ... were added to media-removed cell monolayers per single well of 12 well plates followed by on-column DNA digestion and purification (Zymo Research). For RNA purification from RNP capture sample ...
-
bioRxiv - Genetics 2022Quote: ... The resulting RNA product was run on 12% SequaGel -UreaGel (national diagnostics) and purified with ZR small-RNA PAGE Recovery KitTM (R1070, ZYMO RESEARCH) following provider’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... nojo-1 and nojo-2 complete roots of plants growing 12 DAS using Quick-RNA Miniprep (Zymo Research, Irvine, CA, USA). Complementary DNA was generated using the SuperScriptTMII Reverse Transcriptase (InvitrogenTM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Universally methylated mouse DNA standard (cat. no. D5012, Zymo Research) and Mlh1−/− tissues were used as Mlh1+/+ and Mlh1−/− allele controls ...
-
bioRxiv - Genomics 2021Quote: Samples (n=12) were collected from nasopharyngeal and oropharyngeal swabs of patients in viral transport medium62–65 or DNA/RNA Shield™ (Zymo Research, USA) abides by the Center for Disease Control’s (CDC ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Genomics 2023Quote: ... Tagmentation was carried out at 55C for 5 minutes before being stopped by the addition of 12 uL of DNA binding buffer (Zymo Research, D4004-1-L) for 5 minutes at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Molecular Biology 2020Quote: ... Universally methylated mouse DNA standard (cat. no. D5012, Zymo Research, Irvine, CA) and genomic DNA extracted from normal spleen was used as positive and negative controls ...