Labshake search
Citations for Zymo Research :
1 - 50 of 6059 citations for Medium Kit without Serum and with CultureBoost R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Infected Huh-7 cells (with or without medium) or mouse lung tissues were lysed in DNA/RNA shield reagent (Zymo Research) and total RNA was extracted by using RNeasy kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... The eluted RNA (without the magnetic beads) was then recovered from this mixture using a DirectZol kit (Zymo Research) following the manufacturer’s instructions and eluted in 10 µL of water ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA samples isolated from PLC/PRF/5 cells with or without TARBP1 depletion were first subjected to small RNA purification using the Zymo Research RNA Clean & Concentrator-25 kit (Zymo). The isolated small RNAs were heated at 75°C for 2 min to denature tRNA and then incubated with ALKB-D135S protein in buffer containing 300 mM KCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli genomic DNA without sedimentary DNA extract) were considered inhibited and were subsequently purified using the One-Step Inhibitor Removal kit (Zymo Research Europe, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: vIL-6/THP-1 and parental THP-1 cells were infected with or without r219.KSHV for 72h and RNA was purified using the Quick-RNA miniprep kit (Zymo Research, Irvine, CA, USA). Indexed ...
-
bioRxiv - Microbiology 2021Quote: Viral RNA was extracted from serum using a Zymo Viral RNA extraction kit (Zymo Research, Irvine, CA, USA: #R1035) following the manufacturers protocol ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: Viral RNA was extracted from serum using a Zymo Viral RNA extraction kit (Zymo Research, Irvine, CA, USA: #R1035) following the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... cfDNA was isolated from 0.5 - 10 ml of plasma using the Quick-cfDNA Serum & Plasma Kit centrifugation protocol according to the manufacturer’s protocol (Zymo Research). cfDNA was eluted twice in the provided elution buffer or in MilliQ and subsequently stored at −80°C ...
-
bioRxiv - Genomics 2021Quote: ... after pretreatment with 1ul R-Zymolyase (Zymo Research, Irvine, CA) and ∼100 μl of glass beads ...
-
bioRxiv - Pathology 2021Quote: Total viral RNA was isolated from serum using a Zymo Research Corporation Quick-RNATM Viral Kit (Zymo Research, Tustin, CA; #R1040) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: cfDNA was isolated from 5 ml plasma or 5 ml ascites using the Quick-cfDNA Serum & Plasma Kit centrifugation protocol (Zymo Research) for HC ...
-
bioRxiv - Cell Biology 2022Quote: ... PRP22 or SNU13 along with WT control and three independent cultures for young and old cell populations of strain harboring overexpression cassette of ARH1 and WT control were collected at the OD600 = 0.4 on -URA medium to isolate RNA from each culture using Quick-RNA 96 Kit from Zymo Research (Cat ...
-
bioRxiv - Molecular Biology 2021Quote: Three independent cultures for each strain were collected at the OD600=0.4 on YPD medium to isolate RNA from each culture using Quick-RNA 96 Kit from Zymo Research (Cat ...
-
bioRxiv - Microbiology 2023Quote: ... the cells and medium were harvested and subjected to RNA extraction using the Direct-zol RNA MiniPrep Kit (Zymo Research) or Direct-zol-96 RNA Kit (Zymo Research) ...
-
bioRxiv - Microbiology 2021Quote: ... serum was mixed with RNA/DNA shield (Zymo) at a 1:1 ratio ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... serum was mixed with RNA/DNA shield (Zymo) at a 1:1 ratio ...
-
bioRxiv - Microbiology 2020Quote: Total RNAs were isolated from the whole blood samples from zebra finches and serum samples from woodchucks using Quick RNA Viral Kit (Zymo Research; Irvine, CA, USA). The obtained RNA samples were stored at −80°C until further requirement ...
-
bioRxiv - Microbiology 2022Quote: ... The cells and medium were then collected and subjected to RNA extraction using the Direct-zol RNA MiniPrep kit (Zymo Research) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 5µl of each reaction including a negative control without scFv was subsequently transformed into 100 µl Fast Transformation of Mix & Go Competent Cells (Zymo T3001) each and plated on LB plates containing Ampicillin ...
-
bioRxiv - Microbiology 2020Quote: ... RNase R (Lecigen) treatment and follow-up purification (RNA Clean and Concentrator, Zymo) was performed as described in (36) ...
-
bioRxiv - Biochemistry 2023Quote: ... Single colonies were grown in Sc-Ura medium for 1 d and plasmid DNA was purified using Zymoprep II Yeast plasmid Miniprep kit (Zymo Research, CA). Plasmids were then transformed into E ...
-
bioRxiv - Microbiology 2021Quote: ... buffer without any added fecal material) and two microbial mock communities as positive controls (ZymoBiomics Microbial Community Standards; Zymo Research, Irvine, California, USA).
-
bioRxiv - Neuroscience 2023Quote: ... RNase R-treated RNAs were then re-isolated by RNA Clean & Concentrator™-5 (Zymo Research R1014) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated from 5µl of mouse serum using the RNA Clean & Concentrator -5 (Zymo) or High Pure Viral Nucleic Acid kit (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... and serum ALT.’ Purified RNA was submitted to Novogene (CA) in DNA/RNA shield (Zymo Research, CA) for library preparation and RNA-Seq analysis ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... grown in LB medium according to the protocol provided by the manufacturer (Zymo Research). Purified NA06896 DNA was obtained from the Coriell Institute.
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2021Quote: ... the RCC kit (Zymo Research).
-
bioRxiv - Developmental Biology 2020Quote: ... or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo Research). For each transformation ...