Labshake search
Citations for Zymo Research :
1 - 50 of 459 citations for L Valine 13C5 95 97%; 15N 96 99%; 2 3 D2 97%+ since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: Total RNA was isolated from 2-3 million HAP1 cells using the Direct-zol-96 RNA kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2019Quote: Total RNA was isolated from 2-3 million HAP1 cells using the Direct-zol-96 RNA kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 0.1 g of human stool was homogenized in 8 mL salt magnesium plus (SM+) buffer [99] and 0.5 ml of homogenate was transferred to a BashingBead Lysis tube (Zymo) and designated as the whole metagenome sample ...
-
bioRxiv - Neuroscience 2020Quote: ... and sorted into 384-well plates preloaded with 2μl of digestion buffer for snmC-seq215 (20 mL digestion buffer consists of 10 mL M-digestion buffer (2×, Zymo D5021-9), 1 ml Proteinase K (20 mg ...
-
bioRxiv - Microbiology 2020Quote: ... An equal volume of 99% ethanol was added to the aqueous phase and isolation continued using the Direct-Zol RNA Miniprep Plus (Zymo Research, USA) RNA purification kit protocol ...
-
bioRxiv - Microbiology 2022Quote: ... supernatant was mixed with .5mL 95% ethanol and treated using the Direct-zol RNA Miniprep Plus Kit (Zymo Research) and treated with DNAse 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... the resulting solution was incubated with 3 volumes of TRI-reagent at room temperature for 2 hours (R2050-1-50; Zymo Research). The mix was then transferred out of the BSL-3 facilities and nucleic acids were purified using the Direct-zol DNA/RNA miniprep kit (R2080 ...
-
bioRxiv - Microbiology 2020Quote: RNA was extracted from infected cells in the 96-well plate using a ZR-96 Viral RNA Kit (Zymo Research) per manufacturer instructions ...
-
bioRxiv - Genomics 2023Quote: ... Each pool of heads or bodies was placed in a well of 96-well plates and total RNA was extracted using Quick-RNA 96 Kit by Zymo Research (Catalog no ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Neuroscience 2022Quote: ... the supernatant was combined with an equal volume of 95-100% ethanol and transferred to a RCC5 column part of the RNA Clean and Concentrator kit from Zymo Research and manufacturer’s instructions were followed.
-
bioRxiv - Microbiology 2021Quote: Zymo Quick-RNA Viral 96 Kit (Zymo Research) was used to isolate RNA from cell supernatants according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Using a ZR-96 viral RNA kit (Zymo), RNA was extracted from the agar plugs and eluted in 40 µl nuclease free water (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... or ZR-96 Quick-RNA kit (Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Using a ZR-96 viral RNA kit (Zymo), RNA was extracted from the agar plugs and eluted in 40 µl nuclease-free water (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... Using a ZR-96 viral RNA kit (Zymo), RNA was extracted from the agar plugs and eluted in 40 μl nuclease-free water (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... or Direct-zol-96 RNA Kit (Zymo Research). The samples were used for quantitating HuNoV RNA GEs by means of reverse transcription-quantitative PCR (RT-qPCR ...
-
bioRxiv - Microbiology 2022Quote: ... Using a ZR-96 viral RNA kit (Zymo), RNA was extracted from the agar plugs and eluted in 40 μl nuclease-free water (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The EZ-96 DNA Methylation Kit (Zymo Research) was used to perform the bisulphite conversion ...
-
bioRxiv - Genetics 2023Quote: ... 30 samples were collected (5 timepoints x 2 genotypes x 3 replicates) and RNA was extracted using a Direct-zol RNA Miniprep (Zymo Research R2061) using TRIzol Reagent (ThermoFisher Cat # 15596026 ...
-
Parallelized engineering of mutational models using piggyBac transposon delivery of CRISPR librariesbioRxiv - Bioengineering 2020Quote: DNA extraction from clonal iPSC lines cultured in 96-well plates was performed using the Quick-DNA 96 Kit (Zymo Research). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... at -80ºC until DNA extraction with the Zymo Quick DNA 96 Plus and ZR-96 Clean-up kits (Zymo Research, Inc.). High-throughput Illumina 150-bp paired-end libraries for all six samples were prepared and sequenced by Novogene Corporation ...
-
bioRxiv - Biochemistry 2019Quote: ... Beads for protein analysis were incubated with Laemmli buffer and heated at 95°C for 10 min and beads for RNA analysis were exposed to TRI reagent (Zymo Research) for RNA extraction using Direct-Zol (Zymo Research ...
-
bioRxiv - Cell Biology 2021Quote: ... Beads for protein analysis were incuba ted with SDS sample buffer and heated at 95 °Cfor 10 min and beads for RNA analysis were mixed with TRI reagent (Zymo Research) followed by RNA extraction using a Direct-zol RNA purification kits (Zymo Research) ...
-
bioRxiv - Molecular Biology 2023Quote: ... aqueous phase containing cfRNAs was mixed with 1 volume of ethanol (95-100%) and then added to the Zymo-Spin column (Zymo, R1016) for RNA binding ...
-
bioRxiv - Genetics 2021Quote: ... All samples were randomized into 96-well plates for RNA extraction with the Direct-zol-96 RNA Kit (Zymo Research, Irvine, CA). Libraries constructed with the Lexogen QuantSeq 3′ mRNA-Seq Library Kit FWD (Lexogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA from individual eGFP+ cell lines was extracted from 96 well-plates using Quick-DNA Universal 96 Kit (Zymo Research, D4071) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... genomic DNA and RNA were extracted from fresh frozen tumor (n=2) and normal (n=3) samples using the ZR-Duet DNA/RNA MiniPrep extraction kit (ZYMO RESEARCH, Irvine, CA). Quantification was performed with a NanoDrop One™ spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... The cultures were incubated in 96-well blocks (Zymo) at 30 °C with agitation for a total of 8 hours ...
-
bioRxiv - Microbiology 2021Quote: ... and purified with the Direct-zol 96 kit (Zymo, eluted in 20 μL of nuclease-free water).
-
bioRxiv - Genomics 2022Quote: ... The corresponding amount of polyA RNA were incubated with 1X fragmentation buffer at 95 °C for 1 minute to generate ~300 nt of RNA fragment followed by column purification (Zymo Research, R1016) as described before [23] ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were fragmented to around 300nt length at 95°C for 1min and purified using RNA clean and concentrator (Zymo research, R1016). The fragmented RNA was then subjected to a 5’ dephosphorylation reaction at 37°C for 30min by adding rSAP (NEB ...
-
bioRxiv - Developmental Biology 2020Quote: RNA was isolated directly from the TRIzol muscle samples using a 96 well plate extraction kit (Direct-zol™-96 RNA, Zymo Research, #R2054): after thawing to room temperature in 1,5 ml Eppendorf tubes ...
-
bioRxiv - Microbiology 2020Quote: ... pH 7.2) and 3 swabs (2 for metagenomic DNA isolation, 1 for storage) moistened with DNA/RNA shield (Zymo Research, Cat. No. ZYR.R1100-250). Swabbing was performed for 2 min in each site and stored in respective storage liquids (i.e ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then treated with Turbo DNAse 2 to 3 times and then purified with the RNA Clean and Concentrator-5 Kit (Zymo Research Cat#: 11-325) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... 600 ng of purified DNA were randomly distributed on a 96-well plate and processed using the EZ-96 DNA Methylation kit (Zymo Research Corp., CA, USA) following the manufacturer’s recommendations for Infinium assays ...
-
bioRxiv - Genetics 2019Quote: ... DNA was extracted using the Quick-DNA 96 kit (Zymo) and 1-2 ng of DNA was tagmented with Tn5 transposase stored at a concentration of 1.6 mg/ml with pre-annealed oligonucleotides ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and RNA was isolated using Direct-zol 96 (Zymo Research). RNA-seq libraries were prepared from 500 ng of RNA using Quant-seq 3’ FWD (Lexogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... Genomic DNA was isolated using Quick-DNA 96 kit (ZYMO) and used for screening for clones with translocation by PCR (Table S7) ...
-
bioRxiv - Genomics 2023Quote: ... genomic DNA was extracted (Quick-DNA 96 kit; Zymo Research) for qPCR ...
-
bioRxiv - Genomics 2020Quote: ... using the EZ-96 DNAm-Gold kit (Zymo Research, CA, USA). DNAm was quantified using the Illumina Infinium HumanMethylationEPIC BeadChip (Illumina Inc ...
-
bioRxiv - Microbiology 2022Quote: ... using the ZymoBIOMICS-96 MagBead DNA Kit (Zymo Research, Cat. # D4302). The quantity of DNA in each sample was measured with the Quant-iT PicoGreen dsDNA Assay Kit (ThermoFicher ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted using the Quick-DNA 96 kit (Zymo Research). DNA was eluted in 30 µl of molecular H2O ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted using a Quick-DNA 96 kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... using the EZ-96 DNA methylation kit (Zymo Research, CA, USA). DNA methylation was quantified using either the Illumina Infinium HumanMethylation450 BeadChip (Illumina Inc ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were extracted with a Zyppy-96 Plasmid Miniprep kit (Zymo) according to manufacturer instructions and quantified via Nanodrop.
-
bioRxiv - Bioengineering 2022Quote: RNA extraction performed with a Quick-RNA 96 well kit (Zymo). cDNA generation performed with a high-capacity cDNA synthesis kit using random primers and RNase inhibitor (Thermo ...
-
bioRxiv - Immunology 2022Quote: ... RNA was isolated using Direct- zol 96 MagBead RNA kit (Zymo) per manufacturer protocol ...
-
bioRxiv - Microbiology 2022Quote: ... the ZymoBIOMICS®-96 MagBead DNA Kit (Zymo Research, Irvine, CA) was used to extract DNA using an automated platform ...
-
bioRxiv - Microbiology 2023Quote: ... or the Zymo Quick-DNA 96 Kit (Zymo Research, Irvine, CA), respectively ...