Labshake search
Citations for Zymo Research :
1 - 50 of 6895 citations for Human Single stranded DNA binding protein 4 SSBP4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Resultant single-stranded oligos were purified by using Zymo DNA concentration kit (Zymo Research, D4030) modified for short-length DNA cleaning ...
-
bioRxiv - Microbiology 2023Quote: ... Digestion products (presumably single stranded DNA) were purified with a ssDNA clean and concentrate kit (Zymo #7010).
-
bioRxiv - Molecular Biology 2021Quote: ... 10 fully grown GV oocytes (an equivalent of 40 haploid genomes and 80 single-stranded DNAs after bisulfite conversion) were directly subjected to EZ DNA Methylation-Direct kit (Zymo Research) for bisulfite conversion with the following modifications ...
-
bioRxiv - Genomics 2024Quote: ... Prior to library preparation single stranded (ss) DNA was concentrated using the ssDNA/RNA clean & concentrator kit (ZYMO).
-
bioRxiv - Genomics 2020Quote: ... We created libraries from bisulfite-converted single stranded DNA using the Pico Methyl-Seq Library Prep Kit (Zymo Research), which were then pooled for sequencing on an Illumina NextSeq 500 instrument using the NextSeq 500/550 V2 High Output reagent kit (1 × 75 cycles ...
-
bioRxiv - Systems Biology 2023Quote: ... The single-stranded DNA probe was purified using a spin column (Zymo Research, D7010) after RNA digestion with a cocktail of RNase H and RNase A ...
-
bioRxiv - Synthetic Biology 2021Quote: ... for 30 minutes at 37C and then single stranded DNA was isolated from the prep using an ssDNA/RNA Clean & Concentrator kit from Zymo Research ...
-
bioRxiv - Cancer Biology 2022Quote: ... was used for the estimation of global 5-hmC and 5-mC levels by ELISA using the Quest 5-hmC ELISA kit and the 5-mC DNA ELISA kit (Zymo research Inc, USA) according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ...
-
bioRxiv - Biochemistry 2023Quote: ... 1000 µL DNA binding buffer (Zymo) was added ...
-
bioRxiv - Cell Biology 2023Quote: Global DNA methylation was performed in genomic DNA using 5-mC DNA ELISA kit (Zymo Research, USA) following manufacturer’s protocol and that described in (Valdivieso et al. ...
-
bioRxiv - Genomics 2023Quote: ... 20 µL of DNA binding buffer (Zymo) was added to each well and incubated at room temperature for 20 minutes ...
-
bioRxiv - Genetics 2023Quote: ... Chip DNA binding buffer (Zymo, California, USA) was added in a 2:1 ratio and gently inverted to mix ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA from binding and uptake samples was purified using the Quick-DNA Microprep Plus Kit (Zymo research) and by following the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2019Quote: DNA was extracted from single cell colonies using the ZR Duet DNA/RNA Miniprep Kit (Zymo). A 708 bp PCR product around the editing site of Satb2-272 was amplified using primers Satb2-seq-F ACTGGCCTGATCGTCTATCA and Satb2-seq-R GCCAGATCCTAGGTCTCTGT ...
-
bioRxiv - Neuroscience 2023Quote: Genome-wide DNA methylation levels were determined using the 5-mC DNA ELISA Kit (Zymo Research, D5325) per the manufacturer’s instruction ...
-
bioRxiv - Genomics 2020Quote: ... Double-stranded cDNA was cleaned by the DNA Clean & Concentrator™-5 kit (Zymo Research) purified using a 0.6X proportion of AMPure XP beads ...
-
bioRxiv - Bioengineering 2023Quote: Genomic DNA was extracted from single-cell derived clones with the Quick-DNA Miniprep Plus Kit (Zymo Research). The DNA concentration was measured using a NanoDrop ...
-
bioRxiv - Genomics 2023Quote: ... DNA purified from single cells was treated with the EZ Methylation Direct Kit (Zymo) for bisulfite-conversion following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Approximately 50 ng genomic double-stranded DNA per donor was converted with sodium bisulfite using the EZ DNA Methylation-Lightning Kit (Zymo Research) and fragmented by sonication (Covaris S220 ...
-
bioRxiv - Cancer Biology 2020Quote: DNA from single-cell-derived bacterial or cell colonies was extracted with a Quick-DNA Miniprep Kit (Zymo #D3025). Combinatorial primer sets designed to recognize the 5′ and 3′ knock-in boundaries were used with the following PCR cycling conditions ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from single individuals using the ZR Tissue & Insect DNA Kit MicroPrep (Zymo Research, Irvine, CA, USA), according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA samples were also used for global DNA methylation analysis using the 5-mC DNA ELISA Kit (Zymo Research, Irvine, CA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... 220 μL Binding Buffer (from Zymo Kit) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... 30 or 60 s by adding binding buffer from the DNA Clean & Concentrator-25 kit (Zymo Research) supplemented with 30 mM EDTA and 37 mM sodium acetate ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reaction was quenched by adding binding buffer from the DNA Clean & Concentrator-25 kit (Zymo Research) supplemented with 30 mM EDTA and 37 mM sodium acetate ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cDNAs of every single cell were purified using the DNA Clean & Concentrator Kit (Zymo) and loaded and run on 2% agarose gels ...
-
bioRxiv - Molecular Biology 2023Quote: ... then cleaned using DNA Binding Buffer (Zymo ZD4004-1-L) and UPrep Micro Spin Columns (Genesee Scientific 88– 343) ...
-
bioRxiv - Microbiology 2021Quote: Double-stranded DNA was then purified from the lysates using a Zymo Genomic DNA Clean & Concentrator Kit-10 (Zymo Research, Irvine, CA, USA) according to the manufacturer’s protocols ...
-
bioRxiv - Systems Biology 2022Quote: ... the reaction was stopped by adding a DNA binding buffer (Zymo) and purified using a DNA Clean and Concentrate kit (D4004 ...
-
bioRxiv - Bioengineering 2020Quote: ... Single-fly genomic DNA preps were prepared using the solid tissue protocol of the Quick-DNA™ Miniprep Plus Kit (Zymo Research). In total ...
-
bioRxiv - Genetics 2021Quote: ... and purified on DNA-binding columns (Cat# D4029; Zymo Research; Tustin, CA) before a final elution in sterile water ...
-
bioRxiv - Genomics 2019Quote: ... The reaction was stopped by adding 12 μL DNA binding buffer (Zymo) and incubating at room temperature for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sheared gDNA was cleaned using DNA Binding Buffer (Zymo ZD4004-1-L) and UPrep Spin Columns (Genesee Scientific 88-143) ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was further digested into single nucleosides using DNA Degradase Plus (Zymo Research, E2021).
-
bioRxiv - Biochemistry 2023Quote: ... and the DNAs were purified away from protein using a DNA Clean & Concentrator kit (Zymo Research). Both 5’ ends of 1 pmole of the CRISPR leader and array fragments were then labelled with 32P ...
-
bioRxiv - Molecular Biology 2022Quote: ... measured with the 5mC ELISA kit (Zymo Research), to 12 % of the total human 5-methylated cytosine (5mC ...
-
bioRxiv - Genetics 2023Quote: ... we extracted DNA from 2–4 dpf whole larvae using the Quick-DNA Microprep Kit (D3021, Zymo Research). We then performed a PCR for GFP as well as a ‘junction PCR’ to amplify a region including both mitfa and GFP to ensure integration at the intended locus.
-
bioRxiv - Genomics 2022Quote: ... and 118 μl per sample of DNA Binding Buffer (D4004-1-L, Zymo) was added ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reaction was terminated by addition of 12 μL of DNA binding buffer (Zymo) and incubated for 5 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... Round 1 PCRs were cleaned using DNA Binding Buffer (Zymo ZD4004-1-L) and UPrep Micro Spin Columns (Genesee Scientific 88–343) ...
-
bioRxiv - Genomics 2023Quote: ... samples were placed on ice and 5 volumes of DNA Binding Buffer (Zymo) were added to each ...
-
bioRxiv - Plant Biology 2023Quote: ... Relative quantification of 5-methylcytosine (5-mC) over time was determined using the 5-mC DNA ELISA Kit (Zymo Research), using 100 ng of genomic DNA per sample as input ...
-
bioRxiv - Molecular Biology 2020Quote: ... Immediately following digestion the reaction was stopped in the binding buffer from a Zymo ChIP DNA Clean and Concentrator Kit (Zymo Research, D5205) and purified following the protocol in the kit ...
-
bioRxiv - Genomics 2023Quote: ... 350 ng of each extracted sperm DNA and 350 ng of control human NA12878 lymphoblastoid cell line genomic DNA (Coriell Institute) were bisulfite-converted using the Zymo EZ DNA Methylation kit (Zymo Research). The loci were amplified by PCR using the following primer sets ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Linear DNA corresponding to a Fd gene containing a single transposon (1,700 bp) was excised from the gel and purified using a Gel DNA recovery kit (Zymo Research). The Fd-transposon gene fusions were cloned into pFd007-staging using Golden Gate Assembly40 ...
-
bioRxiv - Microbiology 2020Quote: The double stranded deoxyribonucleic acids (dsDNA) was extracted from the duplicate sludge samples using ZR soil microbe DNA kit (Zymo Research, CA., USA), according to manufacturers instructions ...
-
bioRxiv - Genomics 2023Quote: ... DNA was captured on protein A/G agarose beads and purified using the ChIP DNA Clean & Concentrator kit (Zymo) and used for qPCR ...
-
bioRxiv - Developmental Biology 2019Quote: The cDNA of all single cells was collected together and further concentrated with the DNA Clean and Concentrator−5 kit (Zymo Research). The Exonuclease I (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... nucleus accumbens and lung of the 4 juvenile and 4 old female mice was bisulfite converted using the EZ DNA methylation Gold kit (Cat# D5006, Zymo Research) according to manufacturer’s instructions and eluted ...