Labshake search
Citations for Zymo Research :
1 - 50 of 6059 citations for Human Neuronal Acetylcholine Receptor Subunit Alpha 7 CHRNA7 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... was used for the estimation of global 5-hmC and 5-mC levels by ELISA using the Quest 5-hmC ELISA kit and the 5-mC DNA ELISA kit (Zymo research Inc, USA) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... measured with the 5mC ELISA kit (Zymo Research), to 12 % of the total human 5-methylated cytosine (5mC ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from human iPSC-FBs and mouse Raw 264-7 cells using the Direct-Zol RNA kit (Zymo Research) according to manufacturer instructions ...
-
bioRxiv - Genetics 2023Quote: Neuronal cell pellets were used to isolate the total RNA using Quick-RNA MiniPrep Kit (Zymo Research #R1054) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... and 7) ZymoBIOMICS™ DNA Microprep kit (Zymo Research, California, USA) with modifications ...
-
bioRxiv - Microbiology 2021Quote: ... coli DH5 Alpha Competent Cells (Zymo Research) per the manufacturer’s instructions and isolated using a QIAprep Spin Miniprep Kit (QIAGEN) ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ...
-
bioRxiv - Bioengineering 2024Quote: ... and bacterial transformations (Mix & Go! Competent Cells - DH5 Alpha, Zymo). DNA constructs were sequence confirmed by Sanger Sequencing (Elim Bio ...
-
bioRxiv - Neuroscience 2023Quote: Genome-wide DNA methylation levels were determined using the 5-mC DNA ELISA Kit (Zymo Research, D5325) per the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: Global DNA methylation was performed in genomic DNA using 5-mC DNA ELISA kit (Zymo Research, USA) following manufacturer’s protocol and that described in (Valdivieso et al. ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... age-matched (7-10 days post eclosion adults) using Zymo Quick-DNA extraction kit (Zymo D3012). The 16S V1-V2 region was amplified ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was extracted from 7-day old gemmae using Direct-Zol RNA MINIprep kit (Zymo Research) following manufactures instructions ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Products were transformed into Mix and Go! DH5 alpha competent cells (Zymo). Clones were selected by ampicillin resistance on Amp-LB plates (60mg/mL) ...
-
bioRxiv - Genomics 2022Quote: ... were synchronized in either G1 with alpha-factor (Zymo Research, CAT. Y1001), or in late anaphase ...
-
bioRxiv - Zoology 2024Quote: ... These amplified products were then purified as above and restriction enzyme digested CCHa1R and CCHa2R sequences were ligated into pcDNA3.1+ and pBudCE4.1 mammalian expression vectors followed by bacterial transformation and plasmid DNA purification to obtain a large quantity of receptor constructs using ZymoPURE II Plasmid Midiprep Kit (Zymo Research, Tustin, CA, USA) following the manufacturer recommendation ...
-
bioRxiv - Pathology 2023Quote: ... Calculations of alpha and beta diversity were done by standard methodology by Zymo Research.
-
bioRxiv - Plant Biology 2023Quote: ... Relative quantification of 5-methylcytosine (5-mC) over time was determined using the 5-mC DNA ELISA Kit (Zymo Research), using 100 ng of genomic DNA per sample as input ...
-
bioRxiv - Genomics 2021Quote: RNA from human RPTECs was extracted using the Direct-zol MicroPrep Plus Kit (Zymo) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids were propagated by transforming Escherichia Coli (Mix&Go! Competent Cells - DH5 Alpha, Zymo Research) using standard procedures ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted from primary human PTC with the Direct-zol MicroPrep Kit (Zymo) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: Four 7 micron sections of the left ventricle were used to isolate total RNA using the Quick-RNATM FFPE kit (Zymo Research). 1 µg of total RNA was used to generate cDNAs using the SuperScript™ VILO™ cDNA Synthesis Kit ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA samples were also used for global DNA methylation analysis using the 5-mC DNA ELISA Kit (Zymo Research, Irvine, CA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: RNA from human RPTECs was extracted with the TRIZOL and Direct-zol MicroPrep Plus Kit (Zymo) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Digestion was confirmed with methylated and unmethylated human DNA standards provided with the OneStep qMethyl kit (Zymo) as per manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... 3 μl of reaction mix were transformed into Mix & Go! Competent Cells - DH5 Alpha (Zymo Research Corporation, Irvine, CA). Correct assembly was checked by colony PCR followed by Sanger sequencing of the gene fragment region and the Gibson junctions ...
-
bioRxiv - Microbiology 2022Quote: For human OE and OB RNA was extracted from 10mg of tissue per sample using Direct-zol RNA kit from Zymo Research (Catalog #R2052) ...
-
bioRxiv - Genomics 2023Quote: ... 350 ng of each extracted sperm DNA and 350 ng of control human NA12878 lymphoblastoid cell line genomic DNA (Coriell Institute) were bisulfite-converted using the Zymo EZ DNA Methylation kit (Zymo Research). The loci were amplified by PCR using the following primer sets ...
-
bioRxiv - Cancer Biology 2023Quote: RNA from exponentially growing or senescent human and bowhead whale primary skin fibroblasts was isolated using the Quick-RNA MiniPrep kit (Zymo Research) according to manufacturer instructions.
-
bioRxiv - Genomics 2019Quote: ... RNA was isolated from different number of murine splenic CD3 positive T cell samples and human oocyte samples by using the Direct-zol™ RNA MiniPrep Kit (ZYMO, cat. R2050). The extracted RNA samples were dissolved into 30 µl of nuclease-free water (Qiagen ...
-
bioRxiv - Systems Biology 2023Quote: ... The reactions were incubated for 15 min at 50 °C and 3 μl were transformed into Mix & Go! Competent Cells - DH5 Alpha (Zymo Research Corporation, Irvine, CA). Correct assembly was checked by colony PCR followed by Sanger sequencing of the gene fragment region and the Gibson junctions ...
-
bioRxiv - Microbiology 2022Quote: The ZymoBIOMICS human fecal reference sample (Zymo D6323) was thawed at room temperature and 100 μL was taken and centrifuged at 35g for 20 minutes to separate cells from large fecal particles ...
-
bioRxiv - Neuroscience 2019Quote: ... Methylated and unmethylated human gDNAs (Zymo Research, Irvine, CA) were bisulfite-converted using the EZ DNA Methylation-Gold kit (Zymo Research ...
-
bioRxiv - Genomics 2021Quote: ... The Human Methylated & Non-methylated DNA Set (ZYMO Research) was used to generate DNA methylation standards ...
-
bioRxiv - Immunology 2020Quote: ... whole zebrafish larvae or human biopsies using TRI Reagent (Zymo Research) or TRIzol (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... 7) We verified the presence of high molecular weight DNA products in the samples before purifying nucleic acids by Zymo DNA Clean & Concentrator-5 (ZYMO Research).
-
bioRxiv - Microbiology 2021Quote: Infected Huh-7 cells (with or without medium) or mouse lung tissues were lysed in DNA/RNA shield reagent (Zymo Research) and total RNA was extracted by using RNeasy kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: Cultured or purified human cells were lysed directly in RNA lysis buffer (Zymo Research) and homogenized by pipetting ...
-
bioRxiv - Immunology 2024Quote: ... Bisulfite conversion was confirmed by PCR using Universal Methylated Human DNA Standard with hMLH1 Primers (Zymo Research). Converted DNA was then applied to an Illumina Infinium MethylationEPIC850 BeadChip (865918 probes ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).