Labshake search
Citations for Zymo Research :
1 - 50 of 6049 citations for Human Hepcidin Hepc CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: RNA from human RPTECs was extracted using the Direct-zol MicroPrep Plus Kit (Zymo) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted from primary human PTC with the Direct-zol MicroPrep Kit (Zymo) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: RNA from human RPTECs was extracted with the TRIZOL and Direct-zol MicroPrep Plus Kit (Zymo) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Digestion was confirmed with methylated and unmethylated human DNA standards provided with the OneStep qMethyl kit (Zymo) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: For human OE and OB RNA was extracted from 10mg of tissue per sample using Direct-zol RNA kit from Zymo Research (Catalog #R2052) ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from human iPSC-FBs and mouse Raw 264-7 cells using the Direct-Zol RNA kit (Zymo Research) according to manufacturer instructions ...
-
bioRxiv - Genomics 2023Quote: ... 350 ng of each extracted sperm DNA and 350 ng of control human NA12878 lymphoblastoid cell line genomic DNA (Coriell Institute) were bisulfite-converted using the Zymo EZ DNA Methylation kit (Zymo Research). The loci were amplified by PCR using the following primer sets ...
-
bioRxiv - Cancer Biology 2023Quote: RNA from exponentially growing or senescent human and bowhead whale primary skin fibroblasts was isolated using the Quick-RNA MiniPrep kit (Zymo Research) according to manufacturer instructions.
-
bioRxiv - Genomics 2019Quote: ... RNA was isolated from different number of murine splenic CD3 positive T cell samples and human oocyte samples by using the Direct-zol™ RNA MiniPrep Kit (ZYMO, cat. R2050). The extracted RNA samples were dissolved into 30 µl of nuclease-free water (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: The ZymoBIOMICS human fecal reference sample (Zymo D6323) was thawed at room temperature and 100 μL was taken and centrifuged at 35g for 20 minutes to separate cells from large fecal particles ...
-
bioRxiv - Neuroscience 2019Quote: ... Methylated and unmethylated human gDNAs (Zymo Research, Irvine, CA) were bisulfite-converted using the EZ DNA Methylation-Gold kit (Zymo Research ...
-
bioRxiv - Genomics 2021Quote: ... The Human Methylated & Non-methylated DNA Set (ZYMO Research) was used to generate DNA methylation standards ...
-
bioRxiv - Immunology 2020Quote: ... whole zebrafish larvae or human biopsies using TRI Reagent (Zymo Research) or TRIzol (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: Cultured or purified human cells were lysed directly in RNA lysis buffer (Zymo Research) and homogenized by pipetting ...
-
bioRxiv - Immunology 2024Quote: ... Bisulfite conversion was confirmed by PCR using Universal Methylated Human DNA Standard with hMLH1 Primers (Zymo Research). Converted DNA was then applied to an Illumina Infinium MethylationEPIC850 BeadChip (865918 probes ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo DNA Clean and Concentrator kit: ‘Zymo kit’) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformation kit (Zymo Research) or standard electro-transformation protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... or MiniPrep Kit (R2052, Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli Transformation Kit (Zymo Research).
-
bioRxiv - Synthetic Biology 2021Quote: ... coli Transformation Kit from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2021Quote: ... the RCC kit (Zymo Research).
-
bioRxiv - Developmental Biology 2020Quote: ... or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo Research). For each transformation ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNA purification kit (Zymo). cDNA was generated using Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... ZymoPure Midiprep Kit (Zymo Research) was used to prepare donor constructs for embryo injection ...
-
bioRxiv - Microbiology 2024Quote: ... Correct amplicons were isolated by Zymo PCR purification kit (Zymo Research). The PCR products were cloned into a PCR linearized pEcgRNA-guide plasmid to make the pEcgRNA-guide-RT plasmid using In-fusion® HD-cloning kit (Takara Bio ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli Transformation Kit (Zymo Research), and transformations were carried out using 50 ng of ligation product or plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli Transformation Kit (Zymo Research). Plasmids were prepared following standard protocols ...
-
bioRxiv - Biochemistry 2021Quote: ... Zyppy™ Plasmid Miniprep kit and DNA Clean & Concentrator™ kit were purchased from Zymo Research ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total RNA was isolated from using DNA/RNA Duet Kit miniprep kit (Zymo Research, USA).
-
bioRxiv - Genetics 2022Quote: ... cerevisiae temperature-sensitive strain TSA64 en masse using EZ Kit Yeast Transformation kit (Zymo Research). The entire transformed library was grown in selective media (YPD + clonNAT ...
-
bioRxiv - Genetics 2024Quote: ... cerevisiae double mutant strain sml1Δ rad53Δ using the EZ Kit Yeast Transformation kit (Zymo Research) to obtain ∼1,000,000 clones per region ...
-
bioRxiv - Synthetic Biology 2022Quote: ... whereas Zymoclean Gel DNA Recovery Kit and Zymoprep Yeast Plasmid Miniprep Kits were purchased from Zymo Research (Irvine ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted using a ‘Quick-DNA™’ Fungal/Bacterial 96 kit extraction kit (Zymo Research). A Nextera DNA library preparation kit (Illumina ...