Labshake search
Citations for Zymo Research :
1 - 50 of 6060 citations for Human Cholecystokinin 12 CCK12 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... #12 DNA were purified using the OneStep PCR Inhibitor Removal Kit (Zymo Research, CA, USA). Then ...
-
bioRxiv - Genomics 2021Quote: RNA from human RPTECs was extracted using the Direct-zol MicroPrep Plus Kit (Zymo) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted from primary human PTC with the Direct-zol MicroPrep Kit (Zymo) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... This reaction was purified and concentrated in 12 μl water using the DNA Clean & Concentrator™ kit (Zymo, #D4033) and transformed into electrocompetent SURE 2 cells (Agilent ...
-
bioRxiv - Genomics 2022Quote: RNA from human RPTECs was extracted with the TRIZOL and Direct-zol MicroPrep Plus Kit (Zymo) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: RNA was isolated from mid-log phase protists grown at normal growth temperature or 12°C using the Direct-zol RNA Miniprep kit (Zymo). RNA libraries were generated using the KAPA Stranded mRNA Sequencing Kit (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... Digestion was confirmed with methylated and unmethylated human DNA standards provided with the OneStep qMethyl kit (Zymo) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA from either CD34+ cells sorted after transduction or bulk cells at day 12 of culture was extracted using Direct-Zol RNA MicroPrep Kit (Zymo Research) and reverse transcription was performed with SuperScript Vilo cDNA Synthesis Kit (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... total RNA from biological triplicates of HMLE-Twist and HMLE-pBp cells was extracted (12 biological samples in total) with Quick-RNA Miniprep kit (Zymo Research) according to manufacturer protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... the supernatant was reverse-crosslinked overnight (12-16 hours) at 65°C prior to ChIP DNA isolation using Zymogen ChIP DNA Clean and Concentrator Kit (Zymo Research, D5205). For ChIP-seq ...
-
bioRxiv - Neuroscience 2023Quote: Primary cortical neurons were infected at 3 DIV with FL1 and at 10-12 DIV neurons were harvested and DNA extracted using Quick-DNA Miniprep Kit (Zymo Research, USA) following manufacturer recommendations ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from the subset of 12 samples utilized for metagenomics using the Zymobiomics DNA/RNA Mini Kit (Zymo Research, CA, USA) and RNA was cleaned ...
-
bioRxiv - Microbiology 2022Quote: For human OE and OB RNA was extracted from 10mg of tissue per sample using Direct-zol RNA kit from Zymo Research (Catalog #R2052) ...
-
bioRxiv - Genetics 2020Quote: ... then eluted using 12 μl of elution buffer (Zymo Research). Bisulfite-converted DNA (4 μl ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from human iPSC-FBs and mouse Raw 264-7 cells using the Direct-Zol RNA kit (Zymo Research) according to manufacturer instructions ...
-
bioRxiv - Genomics 2023Quote: ... 350 ng of each extracted sperm DNA and 350 ng of control human NA12878 lymphoblastoid cell line genomic DNA (Coriell Institute) were bisulfite-converted using the Zymo EZ DNA Methylation kit (Zymo Research). The loci were amplified by PCR using the following primer sets ...
-
bioRxiv - Cancer Biology 2023Quote: RNA from exponentially growing or senescent human and bowhead whale primary skin fibroblasts was isolated using the Quick-RNA MiniPrep kit (Zymo Research) according to manufacturer instructions.
-
bioRxiv - Genomics 2019Quote: ... The reaction was stopped by adding 12 μL DNA binding buffer (Zymo) and incubating at room temperature for 5 min ...
-
bioRxiv - Genomics 2019Quote: ... RNA was isolated from different number of murine splenic CD3 positive T cell samples and human oocyte samples by using the Direct-zol™ RNA MiniPrep Kit (ZYMO, cat. R2050). The extracted RNA samples were dissolved into 30 µl of nuclease-free water (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: The ZymoBIOMICS human fecal reference sample (Zymo D6323) was thawed at room temperature and 100 μL was taken and centrifuged at 35g for 20 minutes to separate cells from large fecal particles ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reaction was terminated by addition of 12 μL of DNA binding buffer (Zymo) and incubated for 5 minutes at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... Methylated and unmethylated human gDNAs (Zymo Research, Irvine, CA) were bisulfite-converted using the EZ DNA Methylation-Gold kit (Zymo Research ...
-
bioRxiv - Genomics 2021Quote: ... The Human Methylated & Non-methylated DNA Set (ZYMO Research) was used to generate DNA methylation standards ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 μL CircLigase) for 12 hours at 60°C and subsequently purified by Zymo RNA Clean & Concentrator 5 columns (100 μL sample ...
-
bioRxiv - Neuroscience 2023Quote: ... The reaction was stopped with 12 uL of DNA binding buffer (Zymo Research, D4004-1-L). Ampure-based bead purification ...
-
bioRxiv - Immunology 2020Quote: ... whole zebrafish larvae or human biopsies using TRI Reagent (Zymo Research) or TRIzol (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: Cultured or purified human cells were lysed directly in RNA lysis buffer (Zymo Research) and homogenized by pipetting ...
-
bioRxiv - Microbiology 2023Quote: ... The 60 samples were pooled into 5 groups of 12 samples each during purification using RNA Clean & Concentrator (Zymo Research) and all eluted with 16µl DEPC UltraPure water.
-
bioRxiv - Microbiology 2020Quote: ... were added to media-removed cell monolayers per single well of 12 well plates followed by on-column DNA digestion and purification (Zymo Research). For RNA purification from RNP capture sample ...
-
bioRxiv - Genetics 2022Quote: ... The resulting RNA product was run on 12% SequaGel -UreaGel (national diagnostics) and purified with ZR small-RNA PAGE Recovery KitTM (R1070, ZYMO RESEARCH) following provider’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... nojo-1 and nojo-2 complete roots of plants growing 12 DAS using Quick-RNA Miniprep (Zymo Research, Irvine, CA, USA). Complementary DNA was generated using the SuperScriptTMII Reverse Transcriptase (InvitrogenTM ...
-
bioRxiv - Genomics 2021Quote: Samples (n=12) were collected from nasopharyngeal and oropharyngeal swabs of patients in viral transport medium62–65 or DNA/RNA Shield™ (Zymo Research, USA) abides by the Center for Disease Control’s (CDC ...
-
bioRxiv - Immunology 2024Quote: ... Bisulfite conversion was confirmed by PCR using Universal Methylated Human DNA Standard with hMLH1 Primers (Zymo Research). Converted DNA was then applied to an Illumina Infinium MethylationEPIC850 BeadChip (865918 probes ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Genomics 2023Quote: ... Tagmentation was carried out at 55C for 5 minutes before being stopped by the addition of 12 uL of DNA binding buffer (Zymo Research, D4004-1-L) for 5 minutes at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Molecular Biology 2022Quote: ... ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... ZymoPURE II Midiprep Kit or the ZymoPURE II Maxiprep Kit (all Zymo Research).
-
bioRxiv - Immunology 2023Quote: ... the RNeasy Plus kit (specifically, the Quick RNA miniprep plus kit, Zymo, USA) was utilized and RNA was quantitated with Qubit RNA HS (High Sensitivity ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA and RNA were extracted using commercial kits: Quick-DNA-fungal/bacterial MiniPrep™ kit (ZymoResearch) was used for DNA and Quick-RNA-fungal/bacterial MiniPrep™ kit (Zymo Research) was used for RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...