Labshake search
Citations for Zymo Research :
1 - 12 of 12 citations for Diphtheria Toxin CRM197 Mutant since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: Plasmids encoding the wildtype and ompK36 mutants were isolated using miniprep (Zymo) and amplified by PCR using a forward primer containing the T7 promoter sequence (TAATACGACTCACTATAGGAAAAGGCATATAACAAACAGAGGG ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from Enterococcus mutants using the Quick-DNA Microprep Kit (Zymo #D3020). Before Enterococcus DNA extraction ...
-
bioRxiv - Genetics 2024Quote: ... cerevisiae double mutant strain sml1Δ rad53Δ using the EZ Kit Yeast Transformation kit (Zymo Research) to obtain ∼1,000,000 clones per region ...
-
bioRxiv - Genetics 2020Quote: ... ACE2 mutant library yeast display plasmids were rescued using the ZymoPrep Yeast Plasmid Miniprep II kit (Zymo Research). Rescued plasmids were amplified via electroporation into 10G Supreme E ...
-
bioRxiv - Cell Biology 2020Quote: Total mRNA for Real-Time quantitative (q)RT-PCR studies of small intestine of control and mutant mice was isolated as per the manufacturer’s instruction using a quick RNA micro prep kit (Zymo research) as described previously [8] ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted from pools of mutants using a ‘Quick-DNA™’ Fungal/Bacterial 96 kit extraction kit (Zymo Research). DNA was then fragmented using a Nextera DNA library preparation kit (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: mIMCD3 wild type and Jade mutant cells were washed with PBS and RNA extraction was performed with the Direct-zol RNA Miniprep kit (Zymo Research) following the manufacturer’s instructions including a DNase1 treatment step ...
-
bioRxiv - Bioengineering 2019Quote: DNA associated with the mutants recovered from the fourth round of screening was isolated using a Zymoprep yeast plasmid miniprep II kit (Zymo Research). For both the TOM22 and c-Kit screens ...
-
bioRxiv - Cell Biology 2021Quote: ... was extracted from whole blood via cardiac puncture from 6-8-week-old Fzd2tm1Eem (homozygous flox or homozygous global mutants created by crossing with CMV-cre mice) or Fzd2tm1Vari (homozygous flox) animals using Quick-DNA™ Miniprep Plus Kit (Zymo Research). Illumina libraries were constructed with average insert sizes of ∼800 bp and sequenced on an Illumina NovaSeq6000 using paired-end 150bp reads ...
-
bioRxiv - Plant Biology 2019Quote: Total RNA from 4 weeks old Arabidopsis thaliana WT Col-0 and mta mutant plants was isolated using Direct-zol™ RNA kit (Zymo Research). RNA was quantified by Qubit RNA Assay Kit (Life Technologies ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA (gDNA) was isolated from two G1 adults per mutant line using Zymo Quick-DNA MicroPrep kit (Zymo Research, Irvine, CA), and the yield was quantified using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Bioengineering 2023Quote: ... Undigested bands corresponding to mutant PCR products were gel extracted with the Zymoclean Gel DNA Recovery Kit (Zymo Research, Cat. No./ID: D4007), then cloned into pJET vectors (Thermo Scientific ...