Labshake search
Citations for Zymo Research :
1 - 50 of 6060 citations for Butyric Acid BA CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Nucleic acid was extracted using Quick-RNA Miniprep (Plus) kits from Zymo Research ...
-
bioRxiv - Molecular Biology 2020Quote: ... The remaining nucleic acids were purified using the RNA Clean & Concentrator Kit (Zymo).
-
bioRxiv - Molecular Biology 2023Quote: ... and total nucleic acids were isolated using the Direct-zol RNA kit (Zymo) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... Nucleic acids were extracted using Quick-DNA/RNA Viral Extraction Kits (Zymo D7021) and tested for influenza A by RT-qPCR using CDC protocols15 on a Bio-Rad CFX96 instrument.
-
bioRxiv - Microbiology 2021Quote: ... The competition experiments nucleic acids were extracted using the Quick-RNA Viral 96 kit (Zymo research) and the RT-qPCR primers described in Extended Data Table 2 ...
-
bioRxiv - Microbiology 2022Quote: Total nucleic acids were extracted using the Quick-DNA Fecal/Soil Microbe Microprep Kit (Zymo Research) and stored at −20 °C until amplicon or metagenomic sequencing ...
-
bioRxiv - Microbiology 2024Quote: Total nucleic acid was extracted using the Quick-DNA Fecal/Soil Microbe Miniprep Kit (Zymo Research) and stored at −20 °C until amplicon sequencing could be performed ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid was extracted from samples using the Direct-zol RNA Miniprep Plus Kit (Zymo Research, USA). Samples were then subjected to the Sequence Independent Single Primer Amplification (SISPA ...
-
bioRxiv - Bioengineering 2022Quote: ... DMS-modified nucleic acids were purified using a Zymo RNA Clean and Concentrator-5 Kit (Zymo Research) and eluted in 10 μl RNase-free water.
-
bioRxiv - Microbiology 2019Quote: Total nucleic acids (DNA and RNA) were extracted from samples using the ZymoBIOMICS DNA/RNA Miniprep Kit from Zymo Research (R2002 ...
-
bioRxiv - Neuroscience 2022Quote: ... Then the nucleic-acid bound protein isolation was performed using buffers from the Quick-RNA Miniprep Kit (Zymo Research) and the Zymo-Spin IIICG Column (Zymo Research) ...
-
bioRxiv - Genomics 2023Quote: ... RNA was extract using either acid phenol extraction (Ares, 2012) or Direct-zol RNA miniprep kit (Zymo Research #R2053). Samples extracted with Direct-zol RNA miniprep kit were disrupted by vortexing with glass beads (Sigma-Aldrich #Z250465 ...
-
bioRxiv - Genomics 2024Quote: All nucleic acid extraction for 16S rRNA amplicon sequencing was performed using ZymoBIOMICS DNA/RNA Miniprep Kit (Zymo Research) and stored at −20 °C until further processed ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.075% 5-fluorooritic acid (Zymo Research)) ...
-
bioRxiv - Microbiology 2023Quote: ... Total nucleic acids were extracted from the Sterivix filters using the Zymo Direct-zol DNA/RNA Miniprep kit (Zymo Research). Extracted DNA was quantified using a Qubit v3.0 (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... S26) were subject to a dual nucleic acid isolation protocol using the DNA/RNA Mini Prep Plus kit from Zymo Research (Irvine ...
-
bioRxiv - Biochemistry 2024Quote: Total RNA was extracted using hot acid phenol method followed by purification using Direct-zol RNA Miniprep Kit (Zymo Research). The RNA was treated with DNaseI ...
-
bioRxiv - Microbiology 2020Quote: ... a nucleic acid stabilizing solution from Zymo Research (R1100) ...
-
bioRxiv - Bioengineering 2021Quote: ... 10 mL 5-Fluoroorotic Acid (Zymo Research), 50 mg uracil (MP Biomedicals 103204) ...
-
bioRxiv - Neuroscience 2022Quote: ... The mix was then transferred out of the BSL-3 facilities and nucleic acids were purified using the Direct-zol DNA/RNA miniprep kit (R2080; Zymo Research). The kit columns were substituted with Zymo-Spin IC Columns (C1004-50 ...
-
bioRxiv - Microbiology 2020Quote: Nucleic acid samples were extracted directly from oro-pharyngeal swab samples using a Direct-zol™ RNA MiniPrep Plus extraction kit (Zymo Research) and in full compliance to the manufacturers’ recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... 5-Fluoroorotic acid (5-FOA; ZYMO RESEARCH F9003), or doxycycline (Sigma D9891) ...
-
bioRxiv - Microbiology 2020Quote: The double stranded deoxyribonucleic acids (dsDNA) was extracted from the duplicate sludge samples using ZR soil microbe DNA kit (Zymo Research, CA., USA), according to manufacturers instructions ...
-
bioRxiv - Microbiology 2020Quote: ... the nucleic acids were resuspended in DEPC-treated nuclease-free water purified with the OneStep PCR Inhibitor Removal Kit (Zymo Research, Irvine, USA), then split into a fraction for DNA and one for RNA ...
-
bioRxiv - Microbiology 2020Quote: ... The YAC DNA was extracted using spin column-based nucleic acid purification (ZR BAC DNA Miniprep Kit, ref. D4049, Zymo Research, Irvine, CA). The YAC containing viral cDNA was transformed into E ...
-
bioRxiv - Genomics 2021Quote: Total nucleic acids were extracted from 300 μL of nasopharyngeal samples and eluted with 60 μL sterile RNase-free water using a commercial kit (Zymo total nucleic acid, USA). Total NA concentration was assayed by Qubit RNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... selective media with 5-fluoroorotic acid (Zymo Research, Tustin, CA), or YPD selective media (YPD G418+) ...
-
bioRxiv - Microbiology 2021Quote: ... subjected to nucleic acid extraction by Direct-Zol RNA MiniPrep (Zymo Research, USA) and analyzed for the presence of LLOV RNA by RT-PCR using LLOV-specific primers ...
-
bioRxiv - Genomics 2021Quote: cfDNA and nucleic acid controls were bisulfite treated according to manufacturer recommendations (Zymo Methylation Lightning Kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... The nucleic acid was purified using a RNA Clean & Concentrator-5 (Zymo Research) and eluted in 7µL H2O.
-
bioRxiv - Molecular Biology 2020Quote: ... Precipitated nucleic acids were further purified and concentrated with Zymo-Spin IIC column (Zymo Research). Obtained RNA was depleted of rRNAs with Ribo-Zero Gold Kit (Human/Mouse/Rat ...
-
bioRxiv - Molecular Biology 2020Quote: ... all samples’ total nucleic acid (TNA) were treated with DNAse 1(Zymo Research, Catalog # E1010), which cuts both double-stranded and single-stranded DNA ...
-
bioRxiv - Microbiology 2023Quote: ... All samples were placed in 1mL of nucleic acid stabilizing solution (DNA/RNA Shield, Zymo Research) in a 2 ml Hamilton FluidX tube and stored at -80°C until processing for DNA extraction and 16S rRNA gene amplicon sequencing.
-
bioRxiv - Molecular Biology 2020Quote: ... Ribonucleic acid (RNA) extraction was performed following the manufacturers guidelines for Direct-Zol™ RNA miniPrep (Zymo). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by acid phenol-chloroform extraction and purification using RNA Clean & Concentrator column cleanup (Zymo Research, #R1014). Input samples were also dephosphorylated and ligated to 3’RNA adapter ...
-
bioRxiv - Bioengineering 2021Quote: ... Selection for pyrF mutations was performed with 5-fluoroorotic acid (5-FOA, Zymo Research, part number F9001-5) at a final concentration of 0.5 mg/ml ...
-
bioRxiv - Genomics 2020Quote: ... 7) We verified the presence of high molecular weight DNA products in the samples before purifying nucleic acids by Zymo DNA Clean & Concentrator-5 (ZYMO Research).
-
bioRxiv - Molecular Biology 2020Quote: ... the shuffle strain transformed with plasmid expressing mutant ribosomal protein products was grown on SDC plates containing 0.5 mg/mL 5-fluoroorotic acid (5-FOA, #F9001-5, Zymo Research) and a strain lacking URA3 was isolated.
-
bioRxiv - Bioengineering 2019Quote: ... the minimal medium was supplemented with 20 μg/ml uracil and 250 μg/ml 5-fluorororic acid (FOA) (Zymo Research) or 60 g/l sucrose (counter-selection with sacB).
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acid extraction and purification were performed using the Quick-DNA/RNA™ Viral MagBead (Zymo Research, Irvine, California, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were purified by Zymo midiprep kit (Zymo D4200) and all cloning was confirmed by Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... coli Transformation Kit (Zymo).
-
bioRxiv - Evolutionary Biology 2022Quote: ... strains were struck to synthetic defined (SD) media (CSM minus arginine, yeast nitrogen base, glucose) containing 5-Fluoroorotic Acid (5FOA) (Zymo Research, Irvine, CA, USA). to isolate cells that spontaneously lost pTC416-SEC53 ...