Labshake search
Citations for Zymo Research :
1 - 50 of 6086 citations for 2'3' cyclic GAMP cGAMP ELISA Kit 384 well Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: Cells were FACS sorted into 384-plate wells containing 2 µl lysis buffer (Zymo M-digestion buffer also containing proteinase K) ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was extracted with Direct-Zol 96 well plate kit (Zymo Research) and eluted into DNase/RNase-free water ...
-
bioRxiv - Cancer Biology 2022Quote: ... was used for the estimation of global 5-hmC and 5-mC levels by ELISA using the Quest 5-hmC ELISA kit and the 5-mC DNA ELISA kit (Zymo research Inc, USA) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... all 384 wells were pooled and purified with two DCC-5 columns (Zymo Research). Libraries were sequenced on a NovaSeq6000 system (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Each pool of heads or bodies was placed in a well of 96-well plates and total RNA was extracted using Quick-RNA 96 Kit by Zymo Research (Catalog no ...
-
bioRxiv - Molecular Biology 2022Quote: ... measured with the 5mC ELISA kit (Zymo Research), to 12 % of the total human 5-methylated cytosine (5mC ...
-
bioRxiv - Genomics 2021Quote: ... The bisulfite conversion reaction was subsequently washed and desulfonated using reduced volumes in a 384-plate spin column (Zymo Research) essentially as described in (Luo et al. ...
-
bioRxiv - Genomics 2022Quote: ... separating 22 or 10 (control wells) single nuclei per well in a 96-well plate containing 2.5 μL of M-digestion buffer (Zymo, Cat. D5020-9), 0.25 μL of Proteinase K (Zymo ...
-
bioRxiv - Microbiology 2020Quote: RNA was extracted from infected cells in the 96-well plate using a ZR-96 Viral RNA Kit (Zymo Research) per manufacturer instructions ...
-
Parallelized engineering of mutational models using piggyBac transposon delivery of CRISPR librariesbioRxiv - Bioengineering 2020Quote: DNA extraction from clonal iPSC lines cultured in 96-well plates was performed using the Quick-DNA 96 Kit (Zymo Research). Briefly ...
-
bioRxiv - Genomics 2023Quote: ... RNA was extracted from each well of a 6-well plate containing ES or DE cells using 1 mL Tripure and the Direct-Zol RNA Extraction kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ...
-
bioRxiv - Genomics 2021Quote: ... or single-nuclei (in 96-well PCR plates provided in the Zymo EZ-96 DNA Methylation-Direct™ Kit loaded with 4µL Proteinase K digestion buffer (1µL M-Digestion Buffer ...
-
bioRxiv - Genetics 2021Quote: ... All samples were randomized into 96-well plates for RNA extraction with the Direct-zol-96 RNA Kit (Zymo Research, Irvine, CA). Libraries constructed with the Lexogen QuantSeq 3′ mRNA-Seq Library Kit FWD (Lexogen ...
-
bioRxiv - Neuroscience 2022Quote: ... total cellular RNA using ∼1×106 cells from one well of a six-well plate was isolated using TRIzol reagent followed by Direct-zol RNA MiniPrep Plus kit purification (Zymo Research # R2070). RNA was quantified using Qubit RNA HS Assay kit and cDNA synthesised from ∼2µg of RNA using SuperScript IV VILO Master Mix kit following gDNA removal with ezDNase ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA from individual eGFP+ cell lines was extracted from 96 well-plates using Quick-DNA Universal 96 Kit (Zymo Research, D4071) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cell pellets collected from 48-well plates were lysed and total RNAs were extracted using the Direct-zolTM RNA Miniprep kit (Zymo Research R2053) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... lysate from ∼1×106 cells in the well of a 6-well plate was collected in 300 µL of DNA/RNA Shield (Zymo). RNA was isolated using the Quick-RNA Miniprep Plus Kit (Zymo ...
-
bioRxiv - Developmental Biology 2020Quote: RNA was isolated directly from the TRIzol muscle samples using a 96 well plate extraction kit (Direct-zol™-96 RNA, Zymo Research, #R2054): after thawing to room temperature in 1,5 ml Eppendorf tubes ...
-
bioRxiv - Microbiology 2020Quote: ... were added to media-removed cell monolayers per single well of 12 well plates followed by on-column DNA digestion and purification (Zymo Research). For RNA purification from RNP capture sample ...
-
bioRxiv - Cancer Biology 2019Quote: ... 600 ng of purified DNA were randomly distributed on a 96-well plate and processed using the EZ-96 DNA Methylation kit (Zymo Research Corp., CA, USA) following the manufacturer’s recommendations for Infinium assays ...
-
bioRxiv - Microbiology 2020Quote: ... The extracted DNA was then purified in the well-plate format using the ZR-96 Clean and Concentrator kit (Zymo research, Irvine, CA US), following manufacturer’s instructions and eluting in 6 µl of the supplied elution buffer ...
-
bioRxiv - Genomics 2020Quote: ... DNA were extracted from clonally expanded cells (from one well of the culture plate) and from Jurkat cells using Quick-DNA™ Miniprep Plus Kits (Zymo research, catalog no. D4068) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA is extracted from individual wells using Zyppy-96 Well Plasmid Miniprep Kit (Zymo Research #D4042) and sent for SANGER sequencing.
-
bioRxiv - Neuroscience 2023Quote: Genome-wide DNA methylation levels were determined using the 5-mC DNA ELISA Kit (Zymo Research, D5325) per the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: Global DNA methylation was performed in genomic DNA using 5-mC DNA ELISA kit (Zymo Research, USA) following manufacturer’s protocol and that described in (Valdivieso et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 and 4 by lysing cells in the 6-well plate in RNA lysis buffer (Zymo) and freezing at −80 °C until extraction ...
-
bioRxiv - Genetics 2023Quote: RNA was extracted from each of the 384 samples in batches of 30 samples using the Direct-zol RNA Miniprep kit (Zymo Research, R2050). Batches consisted of samples from the same tissue and were processed in the order individual samples were collected ...
-
bioRxiv - Biochemistry 2021Quote: 96-well PCR plates with 50 µL of DH10B ‘Mix & Go Competent Cells’ (prepared using Zymo T3001) in each well were prepared beforehand so that high-throughput transfers could be done using multichannel pipettes or the Tecan Fluent ...
-
bioRxiv - Bioengineering 2022Quote: RNA extraction performed with a Quick-RNA 96 well kit (Zymo). cDNA generation performed with a high-capacity cDNA synthesis kit using random primers and RNase inhibitor (Thermo ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was extracted from all samples in parallel using the Direct-ZOL 96 well plate format (Zymo, #R2054), and BRB-seq libraries were prepared as previously described 20 and further detailed by the MercuriusTM Protocol (Alithea Genomics) ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmid was isolated using 96-well yeast miniprep kits (Zymo D2005) according to manufacturer instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... NPCs were lysed in 1ml Trizol(Qiagen)/well and RNA was isolated employing RNA Clean & Concentrator kit (Zymo Research) including digestion of remaining genomic DNA according to producer’s guidelines ...
-
bioRxiv - Developmental Biology 2023Quote: ... NPCs were lysed in 1ml Trizol(Qiagen)/well and RNA was isolated employing RNA Clean & Concentrator kit (Zymo Research) including digestion of remaining genomic DNA according to producer’s guidelines ...
-
bioRxiv - Genetics 2023Quote: ... and cloning as well as DNA extraction kits were sourced from Zymo. The A ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were scraped from each phenotyping plate after defined growth periods and genomic DNA was extracted from each screening plate with Yeastar Genomic DNA kit (Zymo) and amplified using emulsion PCR (EURx Micellula DNA Emulsion & Purification (ePCR ...
-
bioRxiv - Plant Biology 2023Quote: ... Relative quantification of 5-methylcytosine (5-mC) over time was determined using the 5-mC DNA ELISA Kit (Zymo Research), using 100 ng of genomic DNA per sample as input ...
-
bioRxiv - Genetics 2020Quote: ... we used the ZR RNA in-plate extraction kit (ZR-96 Quick-RNA Kit, Zymo Research R1052), which followed the same protocol as the flask RNA extraction above ...
-
bioRxiv - Systems Biology 2019Quote: ... RNA was isolated using the ZR-96-well Quick-RNA kit (Zymo Research) and quantified using either RiboGreen (Life Technologies ...
-
bioRxiv - Genetics 2020Quote: ... Lysates were purified using the ZR-96-well Quick-RNA kit (Zymo Research). RNA was quantified using RiboGreen (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmid was isolated using a 96-well yeast miniprep kit (Zymo D2005) according to kit instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and plasmid was isolated using a 96-well yeast miniprep kit (Zymo D2005) according to kit instructions ...
-
bioRxiv - Genomics 2024Quote: ... RNA was purified using the ZR-96-well Quick-RNA kit (Zymo Research). Gene expression was measured using qPCR with reagents from the Power SYBR Green RNA-to-Ct 1-step kit (Applied Biosystems) ...
-
bioRxiv - Genomics 2019Quote: ... total RNA was extracted using the Quick-RNA 96 well format kit (Zymo Research) with in-column DNase treatment ...
-
bioRxiv - Genomics 2023Quote: ... the supernatant was transferred to a deep 96-well plate and mixed with 400ul of genomic lysis buffer (Zymo, #D3004-1). The mix was stored at -20C to await further processing ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA samples were also used for global DNA methylation analysis using the 5-mC DNA ELISA Kit (Zymo Research, Irvine, CA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... the cells were expanded onto-6 well plates and incubated for an additional 48-hours prior to GFP+/DAPI-gated FACS followed by gDNA/RNA (Zymo Research, D7001), and protein isolation.
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR products from each well were pooled and purified using DNA Clean & Concentrator kit (Zymo). The resulting library was sequenced on an Illumina MiSeq using a MiSeq Reagent Kit v2 (500-cycle ...
-
bioRxiv - Microbiology 2020Quote: Viral RNA was isolated from viral supernatant with Zymo vRNA 96-well extraction kit (Zymo Research) according to manufacturer’s instructions ...