Labshake search
Citations for Zymo Research :
4701 - 4750 of 6691 citations for Glutathione S Transferase GST Fluorescent Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... followed by isopropanol precipitation for large rRNA yields or using Direct-zol RNA miniprep kit (Zymo Research) for low RNA quantities ...
-
bioRxiv - Molecular Biology 2024Quote: ... The band at roughly 3 kb was extracted using a Zymoclean Gel DNA Recovery Kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from mouse tissues using the Quick-RNA MiniPrep kit (#R1055, Zymo Research, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from the pools using the Quick-DNA Fungal/Bacterial Miniprep Kit from Zymo Research (Cat ...
-
bioRxiv - Microbiology 2024Quote: ... after which their genomic DNA was extracted using the Quick-DNA Midiprep Plus Kit (ZYMO Research, #D4075). DNA fragments containing the sgRNA sequences were amplified by PCR using primers lentiGuidePCR1-F (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from bacteria or phage using the Zymo gDNA prep kit (Zymo Research, Corp) or the Promega Wizard kit (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from surface sterilized samples with the ZymoBIOMICS DNA Mini kit (Zymo Research, Irvine, CA) following the manufacturer’s protocol with samples bead beaten on the homogenize setting for 1 min using a BioSpec Products mini-bead beater ...
-
bioRxiv - Microbiology 2024Quote: RNA was extracted from oyster powder (individual) by using the Direct-Zol RNA miniprep kit (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were lysed using lysis buffer from the Quick-DNA/RNA Microprep Plus Kit (D7005, Zymo Research), and flow-through protein was separated according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was extracted from parasites of different morphologies with a Direct-zol extraction kit (Zymo Research). RNA samples were quantified by UV‒Vis ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was extracted from all frozen samples using the Direct-zol RNA MiniPrep kit (Zymo Research) according to the manufacturer’s recommendations ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... cDNA synthesis was immediately followed by a cleanup step using a DNA Clean & Concentrator Kit (Zymo Clean).
-
bioRxiv - Developmental Biology 2021Quote: ... 600 µl of Oligo binding buffer (Zymo Research, D4060-1-40) and 2400 µl of ethanol were added to sample then loaded onto column and followed centrifuge method in manufacture’s instruction ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1 µL DNA Degradase Plus enzyme (Zymo Research, Freiburg, Germany) were added ...
-
bioRxiv - Bioengineering 2019Quote: ... agarose dissolving buffer (ABD) (Zymo Research, cat no. D4001-1-50), Zymo-Spin I (Zymo Research ...
-
bioRxiv - Cancer Biology 2020Quote: ... and lysed in TRI Reagent® (Zymo Research, R2050-1-200). RNA was extracted using the Direct-zol™RNA MiniPrep Kit (Zymo Research ...
-
bioRxiv - Genomics 2022Quote: ... Equal volume of Zymo lysis buffer (Zymo Cat #D7001-1-200) was added (345µl ...
-
bioRxiv - Cell Biology 2024Quote: Cells were harvested using Tri reagent (Zymo, Cat#R2050-1-200) and total mRNA was extracted using the RNA Clean & Concentrator™-5 (Zymo ...
-
bioRxiv - Molecular Biology 2023Quote: ... The other half had urine conditioning buffer (Zymo, #D3061-1-140) added to the sample before placing in the −80°C freezer.
-
bioRxiv - Cell Biology 2023Quote: ... Tissues were homogenized in TRIzol (Zymo Research cat# R2050-1-200) and the aqueous phase containing the RNA fraction was separated by adding chloroform (20% volume of TRIzol) ...
-
bioRxiv - Microbiology 2022Quote: ... macrophages were lysed in TRI Reagent (Zymo Research, R2050-1-50), and total RNA was extracted.
-
bioRxiv - Genomics 2022Quote: Cells were lysed in Tri-reagent (R2050-1-50, Zymo Research) and total RNA was extracted using Quick-RNA Miniprep kit (R1055 ...
-
bioRxiv - Genomics 2022Quote: Cells were lysed in Tri-reagent (R2050-1-50, Zymo Research) and RNA was extracted using the Direct-zol RNA Miniprep kit (Zymo Research) ...
-
bioRxiv - Plant Biology 2019Quote: ... Euroscarf) was transformed with pAG303GAL-Bax or pAG303GAL-GFP using a Frozen-EZ yeast transformation kit (Zymo Research). Transformants (termed Bax1 and GFP1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 200 µL samples and plasmids from each sample were isolated using a Zymo Yeast Miniprep Kit (Zymo Research). Splitting into separate samples here was done to accommodate the capacity of the Yeast Miniprep Kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... Fragments generated by the Tn5 transposase were purified using the DNA Clean and Concentrate kit (Zymo Research, #D4014). Uniquely indexed libraries were obtained by amplification of the purified fragments with indexed primers using 10 cycles of PCR (5 min x 72 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... a mouse 110 kb BAC clone encoding Nctc1 and Igf2 was purchased from Thermo Fisher Scientific (RPCI23.C) and the DNA was prepared with a ZR BAC DNA Miniprep kit (Zymo Research (D4048)) as control ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting DNA was purified using columns and reagents from the EZ DNA Methylation Direct kit (Zymo Research). First-strand synthesis was performed with Klenow Exo-enzyme (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... and 250ng of DNA was bisulfite converted per sample using the EZ DNA Methylation-Gold kit (Zymo Research) according to the manufactuer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant was collected and total RNA were extracted with Direct-zol RNA MiniPrep Plus kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... the plasmid DNA was purified using the ZR Plasmid Miniprep™ Classic Kit (Zymo Research; Irvine, CA, USA) and sequenced (Eurofins MWG Operon GmbH Ebersberg ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed with two volumes of 100% ethanol and purified using an RNA Clean & Concentrator-25 kit (Zymo Research) as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Final clean-up of the amplified library was performed using the DNA clean and concentration kit (Zymo #D4014) and DNA amplicons eluted in 20 μl of H2O ...
-
bioRxiv - Developmental Biology 2021Quote: ... The purified fragments were treated with sodium bisulfite using an EZ DNA Methylation-Gold Kit (Zymo Research D5005). Library amplification and indexing were performed with KAPA HiFi HotStart Uracil+ ReadyMix (2× ...
-
bioRxiv - Genetics 2021Quote: ... RNA was isolated from primary rib chondrocyte cells cultures by using the Directzol-RNA Mini Prep Kit (ZYMO). The purified RNA samples were transcribed to cDNA for miR140-3p and -5p using miRNA cDNA kit (QuantaBio ...
-
bioRxiv - Genetics 2021Quote: ... The microbial DNA was extracted using the Quick-DNA Fecal Microbe Miniprep Kit™ (Zymo Research, Freiburg, Germany) and a 15 min bead-beating step at 30 Hz was applied ...
-
bioRxiv - Genetics 2020Quote: ... and total RNA was extracted 36 hours post-transfection using the Quick-RNA MiniPrep Plus kit (ZYMO Research). Using a primer specific to the 3′ native exon of the pET01 vector ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was isolated from whole cells for qRT-PCR using Quick RNA miniprep plus kit from Zymo Research following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... while total RNA from ovules was isolated using the Direct-zol RNA Microprep Kits (Zymo Research, Cat# R2061). 1.0 μg total RNA (0.1-0.5 μg for ovules ...
-
bioRxiv - Molecular Biology 2021Quote: ... or the Direct-zol RNA MiniPrep kit including the recommended DNase I treatment (Zymo Research; all other samples) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The obtained genomic DNA was purified using the Soil Microbe DNA kit MiniPrep ZR™ (Zymo Research, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA was extracted using a modified Zymo RNA Clean and Concentrator 5 kit (Zymo Research, Irvine, CA, USA). Samples were thawed on ice and 200 μL of chloroform was added ...
-
bioRxiv - Evolutionary Biology 2021Quote: We extracted total RNA from each sample using the Quick-RNA tissue/Insect RNA extraction kit (Zymo Research). The RNA quality of each sample was assessed on an Agilent Bioanalyzer ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA from FACS-sorted hPSC-derived cardiomyocytes was isolated using the Quick-RNA microprep kit (Zymo Research) and submitted to the NYU Genomics Facility for QC ...
-
bioRxiv - Plant Biology 2022Quote: ... Bisulfite conversion had been carried out with the EZ DNA Methylation-Lightning Kit (Zymo Research, Irvine, CA, USA). Libraries were quantified using the Kapa Illumina GA with Revised Primers-SYBR Fast Universal kit (Kapa Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... to remove contaminating DNA and was clean and concentrated with RNA Clean and Concentrator-25 Kit (Zymo Research). 1 µg of cleaned RNA was used to generate cDNA with iScript reverse transcriptase per the manufacturer’s protocol (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... total RNA was extracted from the two transformed lines of 293T cells using RNA Miniprep kit (Zymo Research). For cDNA to be used in RT-PCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RNAs were purified from the eluates using an RNA Clean & Concentrator™-5 kit (R1015, Zymo Research) according to the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2021Quote: ... Bisulfite conversion was performed on 500μg of DNA using Zymo EZ-96 DNA methylation Kit (Zymo Research, USA). DNA methylation profiling was performed using the Illumina Infinium HumanMethylation 450K array (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA (400 ng) from mouse tail was bisulphite converted with the EZ DNA Methylation-Lightning kit (Zymo Research ...