Labshake search
Citations for BestGene :
1 - 14 of 14 citations for Vitamins Trace Elements and Antioxidant Supplements since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Transgenic Flies were generated using standard P-element transformation methods (Bestgene). The following stocks were used ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transgenic flies were generated using standard P-element transformation (BestGene; Chino Hills, CA).
-
bioRxiv - Cell Biology 2019Quote: ... and transgenic flies produced by P element-mediated transformation of standard yw strain (Bestgene). The Fkh-Gal4 transgene was used to drive expression in salivary glands (Henderson and Andrew 2000) ...
-
bioRxiv - Genetics 2021Quote: ... Transgenic lines were generated using standard methods for P-element-mediated germline transformation (BestGene Inc).
-
bioRxiv - Cell Biology 2020Quote: ... The destination vectors were subsequently injected into Drosophila embryos for P-element mediated transformation (BestGene). Note that the pUWG destination vector allowed the expression of wild type dTBCE under the control of the poly-ubiquitin promoter ...
-
bioRxiv - Developmental Biology 2023Quote: ... The single donor plasmids were sent for standard P-element-mediated transformation performed by BestGene (Chino Hills, CA).
-
bioRxiv - Neuroscience 2020Quote: ... selection of P-element and Phi31C transformants and selection of CRISPR/Cas9 knockouts (see below) was performed by BestGene Inc. ...
-
bioRxiv - Genetics 2020Quote: ... pUAST vectors carrying the respective inserts were used to generate transgenic lines by standard p-element insertion (BestGene, CA).
-
bioRxiv - Cell Biology 2022Quote: ... flies carrying an ectopic copy of the CAP-H2 gene and regulatory regions were produced by random P-element integration (Bestgene). Cap-H2 genomic region was amplified using 5’ GCATGAGCGGCCGCGGCGAA TCACTCACGATAGTG 3’ and reverse 5’ GCATGAGGTACCCACAAGA ACATGTGGGAGCTC 3 primers ...
-
bioRxiv - Physiology 2019Quote: ... Sequences integrity were confirmed by GATC Biotech and transgenic lines were generated by using standard methods for P-element mediated germ-line transformation (BestGene).
-
bioRxiv - Microbiology 2023Quote: ... Other original UAS transgenic lines listed below were generated using germline transformation by P-element based plasmid vectors (BestGene Inc.): UASp-Spaid.C290A-EGFP ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryo injection to introduce the transgene into the 2nd-chromosome through P element-mediated transformation was carried out by BestGene Inc.
-
Cdc42 promotes epithelial morphogenesis by coupling Par-complex and Crumbs recruitment via Par6-aPKCbioRxiv - Cell Biology 2019Quote: ... UASp-WASp-CRIB::GFP and UASp-WASp-CRIB::GFPMUT strains were generated by injecting the appropriate DNA constructs for standard P-element transformation (BestGene Inc.) (Rubin and Spradling ...
-
bioRxiv - Developmental Biology 2022Quote: UAS-Lgr4 transgenic flies were generated by injection of the pUASt-Lgr4 construct 19 in w1118 embryos following standard P-element-mediated transformation procedures (BestGene, InC).