Labshake search
Citations for BestGene :
1 - 31 of 31 citations for Mumps Virus Nucleoprotein Strain L Zagreb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... The strains were injected by BestGene Inc ...
-
bioRxiv - Cell Biology 2019Quote: ... The transgenic strains were injected by BestGene Inc ...
-
bioRxiv - Developmental Biology 2022Quote: ... All transgenic strains were generated by Bestgene Inc.
-
bioRxiv - Neuroscience 2020Quote: ... Transformant fly strains were generated by BestGene Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... All fly strains were injected by BestGene Inc.
-
bioRxiv - Cell Biology 2023Quote: ... The transgenic strains were generated by BestGene Inc ...
-
bioRxiv - Synthetic Biology 2019Quote: ... melanogaster strains where generated by microinjection (Bestgene Inc, Ca) and ΦC31 mediated integration of pMM7-10-1 into the X-chromosome attP site of y[1] w[*] P{y[+t7.7]=CaryIP}su(Hw)attP8 (BDSC #32233)28 to make DmXLtTA and the Y-chromosome attP of y1 w*/Dp(2;Y)G ...
-
bioRxiv - Developmental Biology 2019Quote: ... melanogaster strains harbouring UAS-pits were generated by Bestgene (USA). For experiments on adult animals ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... simulans w[XD1] wild-type strain was obtained from BestGene, Inc ...
-
bioRxiv - Developmental Biology 2019Quote: ... the transgenes were injected into attP2 (Strain#8622) P[CaryP]attP268A4 by BestGene Inc ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transgenic flies were generated using strain attP2 by PhiC31 integrase-mediated transgenesis (BestGene).
-
bioRxiv - Developmental Biology 2021Quote: ... Transgenic flies were generated using strain 24482 by PhiC31 integrase-mediated transgenesis (BestGene).
-
bioRxiv - Developmental Biology 2021Quote: ... Transgenic flies were generated using strain attP2 by PhiC31 integrase-mediated transgenesis (BestGene).
-
bioRxiv - Developmental Biology 2021Quote: ... Transgenic flies were generated using strain 24749 by PhiC31 integrase-mediated transgenesis (BestGene).
-
bioRxiv - Developmental Biology 2023Quote: ... Transgenic flies were generated using strain attP2 by PhiC31 integrase-mediated transgenesis (BestGene).
-
bioRxiv - Developmental Biology 2023Quote: ... Transgenic flies were generated using strain attP40 by PhiC31 integrase-mediated transgenesis (BestGene).
-
bioRxiv - Cell Biology 2019Quote: ... and transgenic flies produced by P element-mediated transformation of standard yw strain (Bestgene). The Fkh-Gal4 transgene was used to drive expression in salivary glands (Henderson and Andrew 2000) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Transgenic flies were generated using strain attP2 by PhiC31 integrase-mediated transgenesis (BestGene Inc.).
-
bioRxiv - Neuroscience 2023Quote: ... The resulting constructs were injected into a yv;;attP 3rd chromosome docking strain by BestGene Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... Injections of the gRNA-pBFv-U6.2 vectors to yield transgenic fly strains were performed by BestGene Inc ...
-
bioRxiv - Developmental Biology 2021Quote: ... The DNA was injected into strains P[CaryP]attP2 68A4 and P[CaryP]attP40 25C6 by BestGene Inc California [119] ...
-
bioRxiv - Molecular Biology 2022Quote: ... Microinjection of pCaSpeR2-gNaa30 and selection of transfected strains was performed by BestGene (Chino Hills, CA, USA).
-
bioRxiv - Genetics 2022Quote: ... The gw chiRNA plasmid was injected into embryos of the y1 M(vas-Cas9)ZH2A w1118 strain (BestGene Inc.). Males or females carrying vas-Cas9 and a sgRNA transgene were crossed to W1118 ...
-
bioRxiv - Neuroscience 2020Quote: ... The resulting construct was sent for injection into an attP40 donor site strain by BestGene (Chino Hills, CA, USA).
-
bioRxiv - Genetics 2023Quote: ... The constructs were then injected into M{3xP3-RFP.attP}ZH-86Fb docking site strain (Bischof et al., 2007) by BestGene Inc.
-
bioRxiv - Neuroscience 2021Quote: The appropriate combination of gRNA and donor plasmids was mixed and injected into embryos of vasa-Cas9 strain (Bloomington #51323) by BestGene Inc ...
-
bioRxiv - Cell Biology 2023Quote: ... This plasmid was co-injected along with two gRNA-expressing plasmids (pU6-Bbs1-ChiRNA containing gRNA1: GATCCACTGGCTCTCGCTTA and gRNA2: GCATCAGGTTCACCTCAGAGG in embryos from the nos-Cas9 strain (2nd chromosome, BDSC78781) by Bestgene Inc ...
-
bioRxiv - Developmental Biology 2021Quote: ... Resultant plasmid was verified by sequencing and transgenic flies were generated using strain attP2 by PhiC31 integrase-mediated transgenesis (BestGene Inc.).
-
Cdc42 promotes epithelial morphogenesis by coupling Par-complex and Crumbs recruitment via Par6-aPKCbioRxiv - Cell Biology 2019Quote: ... UASp-WASp-CRIB::GFP and UASp-WASp-CRIB::GFPMUT strains were generated by injecting the appropriate DNA constructs for standard P-element transformation (BestGene Inc.) (Rubin and Spradling ...
-
bioRxiv - Cell Biology 2022Quote: ... The resulting transgenes were injected into w1118 embryos and transgenic strains isolated by standard methods (BestGene Inc. Chino Hills, CA, USA). Both strains used in this study had second chromosome insertions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... plasmids containing the gRNA sequence and dsDNA donor templates were prepared and injected into y,w;nos-Cas9 (II-attP40)/CyO embryos (strain obtained from BestGene Inc. (Chino Hills, CA, USA); it was generated by backcrossing the original strain NIG-FLY CAS-0001 into a y,w background) ...