Labshake search
Citations for Eppendorf :
1 - 50 of 351 citations for pTH Related Protein Splice Isoform 3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... All the 11 samples related to each batch were pooled and dried in SpeedVac (Eppendorf EP022822993) before desalting with Sep-Pak® Plus C18 cartridges ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were eluted in 40 μL of 0.2 M glycine pH 3 for 30 min on a ThermoMixer (Eppendorf) at 900 rpm at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... one milliliter of NS1 recombinant protein (3 mg/ml in 2x PBS) was placed into a 1.5 ml Eppendorf tube (Eppendorf, Germany); and the tube mixed for 66 hours (55°C ...
-
bioRxiv - Microbiology 2023Quote: ... The beads were pelleted (600 x g, 3 min) and the supernatant transferred to a fresh low protein binding tube (Eppendorf). The beads were washed with 1 x 200 µL HPLC-grade water and the washes combined with the original supernatant ...
-
bioRxiv - Systems Biology 2022Quote: ... each SCN was cut into 3 pieces with a scalpel on a glass slide and transferred to a protein LoBind tube (Eppendorf, Hamburg, Germany) prefilled with 250 µL lysis buffer (100 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein extracts were stored in Protein LoBind tubes (Eppendorf) at −80°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein samples were aliquoted into Protein LoBind tubes (Eppendorf) and polymerised at 30°C quiescently for at least 48 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... Precleared protein extracts were transferred to Protein Lobind tubes (Eppendorf) and incubated with pre-washed 50 μl of magnetic-streptavidin beads (MyOne C1 ...
-
bioRxiv - Biophysics 2020Quote: ... Tween treated Protein LoBind tubes (Protein LoBind Tubes (1.5 ml, Eppendorf)) were incubated for 4 hours with 2% aqueous Tween solution (Tween20 ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Protein LoBind tubes (Eppendorf) and epT.I.P.S ...
-
bioRxiv - Cell Biology 2020Quote: ... protein Lobind tubes (Eppendorf). Elution was repeated and the eluates were pooled ...
-
bioRxiv - Microbiology 2022Quote: ... Protein LoBind tubes (Eppendorf) minimized potential adsorption of protein ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Protein-low binding tubes (Eppendorf) were used to make serial dilutions of BODIPY-cyclopamine.
-
bioRxiv - Physiology 2021Quote: ... in protein LoBind tubes (Eppendorf). Probes were then homogenized at 4°C in Bioruptor Pico sonicator (Diagenode) ...
-
bioRxiv - Neuroscience 2024Quote: ... protein low-binding tubes (Eppendorf) were used ...
-
bioRxiv - Biophysics 2024Quote: ... in Protein LoBind Tubes (Eppendorf). Protein levels were normalized via Bradford assay (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein amounts were assessed using a Pierce BCA protein assay kit and spectrophotometer (Eppendorf BioPhotometer). Equal amounts of protein (15 μg ...
-
bioRxiv - Neuroscience 2020Quote: ... The supernatant with eluted biotinylated proteins was carefully transferred to a low-protein-binding tube (Eppendorf) with a 30g needle and stored at −80°C.
-
bioRxiv - Cell Biology 2020Quote: ... transferred to protein LoBind tubes (Eppendorf), and minced ...
-
bioRxiv - Molecular Biology 2020Quote: ... into protein LoBind tubes (Eppendorf, Germany). Just before encapsulation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Low protein binding tubes (022431081, Eppendorf) were used for sample preparation ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein LoBind® tubes from Eppendorf; Trypsin (V5111 ...
-
bioRxiv - Biophysics 2022Quote: ... aliquoted into Protein LoBind tubes (Eppendorf), and stored at 4°C (maximum 48 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... antibodies in Protein LoBind tubes (Eppendorf). Thereafter ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Low protein binding tubes (022431081, Eppendorf) were used for sample preparation ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Genomics 2022Quote: ... Digestion of proteins using a GELFREE 8100 fractionator was performed in protein low binding tubes (Eppendorf, Hamburg, Germany) using the Single-Pot Solid-Phase-enhanced Sample Preparation technique described previously (Hughes et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... Protein was quantified on a BioSpectrometer (Eppendorf) with a Bradford Assay (Bradford Reagent-E530-1L) ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein LoBind microfuge tubes (1.5 ml, Eppendorf) were used to further minimize non-specific binding to the walls of the reaction vessel ...
-
bioRxiv - Microbiology 2020Quote: ... The protein content was colorimetrically determined (Eppendorf Biophotometer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and stored in Protein LoBind tubes (Eppendorf) at −80°C.
-
bioRxiv - Immunology 2022Quote: ... The antigen was diluted in tubes with a low binding capacity for proteins (Eppendorf Protein LoBind Tube 1.5 ml). Second ...
-
bioRxiv - Neuroscience 2019Quote: ... Protein concentration of the supernatant was determined by measuring protein absorbance at 280 nm using a photometer (BioPhotometer, Eppendorf) and employing the Beer-Lambert law ...
-
bioRxiv - Biochemistry 2020Quote: ... Measurements at different protein concentrations were carried out by adding to the reaction small volumes of protein diluted in RB in ‘Protein LoBind’ 1.5 mL tubes (Eppendorf). No oxygen-scavenging or triplet-quenching additives were used.
-
bioRxiv - Biochemistry 2021Quote: ... Dynabeads were separated magnetically and elution buffer containing biotinylated proteins was transferred to a new 1.5 ml LoBind protein tube (Eppendorf). 70 µl of sample was electrophoresed on a NuPAGETM 4-12% Bis-Tris protein gel (Invitrogen) ...
-
bioRxiv - Plant Biology 2019Quote: ... A volume of each protein extract corresponding to 16 mg protein was transferred into a new 5 ml LoBind tube (Eppendorf) containing Dynabeads MyOne Streptavidin C1 (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein concentration was determined according to the Bradford method (BioRad protein Assay, Spectrophotemeter Eppendorf biophotometer plus at 595 nm). Full-length APP and APP-CTFs were resolved on 16.5% Tris-Tricine SDS-PAGE then transferred onto nitrocellulose membranes which were boiled in PBS ...
-
bioRxiv - Biochemistry 2019Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... proteins were dried in a vacuum concentrator (Eppendorf) and resolubilized in 50 µL of 100 mM TEAB ...
-
bioRxiv - Microbiology 2020Quote: ... Hemolymph was collected into protein LoBind tubes (Eppendorf) from 60 cold anesthetized mosquitoes 20 min post-injection into 48 μL collection buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein was loaded in Femtotips II (Eppendorf) and injection was done with an injection pressure of 1.0 hPa ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentrations were measured by using BioSpectrometer (Eppendorf).
-
bioRxiv - Cancer Biology 2023Quote: ... then transferred to a protein LoBind tube (Eppendorf) for overnight digestion ...
-
bioRxiv - Biochemistry 2023Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were mixed in protein LoBind tubes (Eppendorf) and then immediately transferred into a 96-well non-binding plate (Greiner Bio-one) ...