Labshake search
Citations for Eppendorf :
1 - 50 of 120 citations for Rnase 3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: Sample were retrotranscribed in cDNA using 1 µL of RNA with 1 µL of Reverse Transcription Master Mix and 3 µL of RNase-free ultrapure water provided with the kit (Standard Biotools, USA) using a thermal cycler (Eppendorf, Germany) with the following cycles ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.3 unit/ml Prime RNase inhibitor (Eppendorf), and 0.9 units/ml MultiScribeTM Reverse Transcriptase (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... in RNase-free LoBind Eppendorf tubes (Eppendorf # 022431021) and snap-frozen by placing on dry ice ...
-
bioRxiv - Cancer Biology 2021Quote: ... in RNase-free LoBind Eppendorf tubes (Eppendorf # 022431021) and snap-frozen by placing on dry ice ...
-
bioRxiv - Molecular Biology 2024Quote: A total of 350,000 HEK293-T cells were seeded in each well of 6-well plates (#EP0030720113, Eppendorf). Transfection was performed the day after at 40-50% cell confluence ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were directly harvested into a DNAse-/RNase-free 1.5 mL tube (0030108051, Eppendorf). Nuclei were then lysed in 0.5 mL of ChAC-lysis buffer and the nuclei pellet was resuspended in 666 µL crosslinking buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Physiology 2020Quote: ... Bone remnants were transferred into a 1.5 ml RNAse-free reaction tube (Eppendorf AG, Hamburg) containing 1 ml of TRIZOL reagent (Life Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... Neurons were homogenised with a P200 pipette and collected in DNase/RNase free tubes (Eppendorf, 30108051). 200uL of chloroform (Sigma ...
-
bioRxiv - Biophysics 2019Quote: ... The His-SUMO solubility tag was cleaved using His-tagged SUMO protease (from RGO) by incubating at 4°C overnight while gently rocking in protein lobind tubes (Eppendorf). The flow through of the second affinity step was collected and concentrated prior to loading onto a Superdex S200 (26/60 ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Cell Biology 2020Quote: ... and the right lungs were taken out and placed in an RNase-free cryo vial (Eppendorf, Hamburg, Germany). After rapidly frozen with liquid nitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Microbiology 2019Quote: ... swabs were introduced into a DNA/DNase/RNase free 1.5 ml Eppendorf Biopur tube (Cat. N° 0030 121.589, Eppendorf, Germany) containing 500 μl of nuclease free water (Cat ...
-
bioRxiv - Immunology 2020Quote: ... and RNAse free water for a final volume of 13 µl in 0.2 ml PCR Tube Strips (732-0098, Eppendorf). The reaction tubes were transferred into a C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... 100μL of RNAse free water with RNAsin (40 U/mL) was added and samples incubated in a thermomixer (Eppendorf) at 300 rpm for at 55°C for 1h for decrosslinking ...
-
bioRxiv - Bioengineering 2024Quote: ... about five organoids per condition were harvested from the HD plate to DNase- and RNase-free tubes (Eppendorf, 022363344). In the case of 2D cells ...
-
bioRxiv - Genetics 2024Quote: ... using the enzymatic cleanup tissue extraction protocol with proteinase K and RNase A and quantified using a BioSpectrometer (Eppendorf). All other samples were extracted using the BioSprint (QIAGEN ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was eluted with 2 x 100 μl of fresh elution buffer (100 mM dithiothreitol in RNase-free H20) directly into 2 ml lobind tubes (Eppendorf) containing 700μl Buffer RLT (RNeasy MinElute Cleanup Kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed with 400 μL ChIP elution buffer (containing 50 μg RNase A) and incubated at 37 °C at 1,200 rpm on a Thermomixer (Eppendorf, Germany) for 1 h followed by incubating with 2 μL Proteinase K (New England Biolabs ...
-
bioRxiv - Immunology 2022Quote: 500 μL of TRISURE reagent was added to each frozen tissue and these were dissociated in an RNAse free microcentrifuge tube (Eppendorf) using a homogenisation pestle ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was diluted with RNAse free water to a concentration of 500ng/20ul and denatured at 70°C for 15min in a Mastercycler (Eppendorf). Mastermix was prepared by mixing ...
-
bioRxiv - Cell Biology 2023Quote: ... and 450 μl of the aqueous phase (upper layer) was transferred to a new RNase-free centrifuge tube (Biopur, Eppendorf), followed by mixing with 450 μl of isopropanol ...
-
bioRxiv - Physiology 2023Quote: ... and 450 μl of the aqueous phase (upper layer) was transferred to a new RNase-free centrifuge tube (Biopur, Eppendorf), followed by mixing with 450 μl of isopropanol ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Biochemistry 2021Quote: Parasites were cultured in 5% 0+ human erythrocytes (Blood bank, Universitätklinikum Hamburg Eppendorf) in RPMI medium supplemented with 0.5% Albumax at 37°C in an atmosphere of 1% O2 ...
-
bioRxiv - Cell Biology 2023Quote: ... human lung primary cells were processed in 1.5 ml DNA LoBind tubes (Eppendorf), washed in PBS via centrifugation at 400g for 5 min at 4 °C and lysed for 3 min on ice before washing via centrifugation at 500g for 5 min at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... including human and microbial cells (4°C, Eppendorf 5810R centrifuge, 15 min, 3,220 rcf) represented in the “cell pellet” ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Ammonium bicarbonate pH 8.0 and 5 mM DTT) was added to each RNAse eluent which were denatured at 45 °C for 30 min with gentle shaking (Eppendorf, Thermomixer C, 800 rpm). Samples were centrifuged at 5,000 g for 1 min and cooled to room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2019Quote: ... Loaded microfluidic chambers were centrifuged 3 min at 1000 rcf (Eppendorf centrifuge 5430R) to maximize cell adhesion.
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Cell Biology 2020Quote: ... falciparum parasites (strain 3D7) were cultured in human RBCs (O+) (transfusion blood, Universitätsklinikum Hamburg Eppendorf, Hamburg). Cultures were maintained at 37° C in an atmosphere of 1% O2 ...
-
bioRxiv - Microbiology 2022Quote: ... falciparum parasites were cultured in human red blood cells (O+ or B+, Universitätsklinikum Eppendorf, Hamburg, Germany) at 5 % haematocrit in an atmosphere of 1% O2 ...
-
High resolution, serial imaging of early mouse and human liver bud morphogenesis in three dimensionsbioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 table top centrifuge) and resuspended ...
-
bioRxiv - Genomics 2020Quote: ... 3 ml of each bacterial suspension were centrifuged at 6,000 × g (Eppendorf, Westbury, NY) for 2 mins ...
-
bioRxiv - Plant Biology 2020Quote: ... The homogenates were centrifuged at 1,000 g for 3 min (Eppendorf 5430, Hamburg, Germany). The subsequent steps of the RNA extraction were performed on the supernatants according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2019Quote: ... The peptide rOv-GRN-1was concentrated using Centripep with cut-off 3 kDa (Eppendorf) and resuspended in low salt solution ...
-
bioRxiv - Systems Biology 2019Quote: ... and 74.9 °C for 3 minutes in a thermocycler (Mastercycler Pro, Eppendorf, Hamberg, Germany) system as described elsewhere (Jafari et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... for 3 min and then reduced to dryness in a Vacufuge centrifugal concentrator (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: Human erythrocytes (blood group 0+ donated from the blood bank of the University Medical Center Hamburg-Eppendorf) and trophozoites to be examined were washed twice with incomplete TY-I-S-33 medium (200 x g ...
-
bioRxiv - Cell Biology 2023Quote: ... falciparum 3D7 [129] were cultured in human red blood cells (O+; University Medical Center Hamburg, Eppendorf (UKE)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... and centrifuged for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) before use ...
-
bioRxiv - Microbiology 2019Quote: ... all culture samples were centrifuged for 3 min at 15871 rcf (Centrifuge 5424, Eppendorf, Germany) in 1.5-mL reaction tubes ...
-
bioRxiv - Bioengineering 2022Quote: ... the purification was carried out in 3 steps using a standard centrifuge (Eppendorf centrifuge 5425). We washed the sample using ethanol and 2 washing buffers provided by the kit ...