Labshake search
Citations for Eppendorf :
1 - 50 of 331 citations for Recombinant Human Pro NTF3 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and Mastercycler Pro Thermal Cycler (Eppendorf) and was subsequently diluted 1:5 in DEPC water ...
-
bioRxiv - Microbiology 2023Quote: ... in Mastercycler pro S thermocycler (Eppendorf, Germany), with PCR program ...
-
bioRxiv - Immunology 2021Quote: ... on a Mastercycler Pro Thermal Cycler (Eppendorf, UK). Following amplification ...
-
Bacterial Polyphosphates Induce CXCL4 and Synergize with Complement Anaphylatoxin C5a in Lung InjurybioRxiv - Immunology 2022Quote: ... in a Mastercycler pro S (Eppendorf, Hamburg, Germany). Quantitative PCR was performed on a C1000 with CFX real time PCR detection system (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR was performed using Mastercycler® pro (Eppendorf) using the following cycling program ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Master Cycler Pro Device (EPPE6324000.516, Eppendorf, DE). For RT-qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... one milliliter of NS1 recombinant protein (3 mg/ml in 2x PBS) was placed into a 1.5 ml Eppendorf tube (Eppendorf, Germany); and the tube mixed for 66 hours (55°C ...
-
bioRxiv - Microbiology 2021Quote: ... The reactions were undertaken using Mastercycler pro S (Eppendorf) and each contained 0.5 μM PA 1095F forward PCR primer ...
-
bioRxiv - Microbiology 2022Quote: ... 0.4 mM EDTA in Mastercycler PRO Thermal Cycler (Eppendorf) overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Plant Biology 2022Quote: ... or a Mastercycler® pro S (Eppendorf AG, Hamburg, Germany). Initial PCR amplicons were generated through the following cycling program ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The PCR amplification was conducted in a thermocycler (Eppendorf Mastercycler Pro) under the following conditions ...
-
bioRxiv - Microbiology 2020Quote: ... Thermal cycling was carried out using an Eppendorf MasterCycler Pro (Eppendorf). PCR products were separated by 1.5% (w/v ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... All thermocycler reactions were done using Mastercycler® pro S (Eppendorf). cDNA was synthesized as previously described ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA was converted to cDNA on an Eppendorf Mastercycler Pro (Eppendorf) and using Promega reagents ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... sequencing reactions were performed in the Master Cycler pro 384 (Eppendorf) using the ABI BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions were performed in a Mastercycler Pro Thermal Cycler (Eppendorf) with the following program ...
-
bioRxiv - Cancer Biology 2023Quote: ... All reactions were run on a Mastercycler Pro PCR machine (Eppendorf). 3% agarose gels were prepared with a 1:20000 dilution of SYBRSafe DNA gel stain (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... RT-PCR was performed on a Mastercycler Pro thermocycler (Eppendorf, Westbury, NY). PCR products were visualized on a 1% agarose gel.
-
bioRxiv - Genomics 2020Quote: ... Bisulfite-converted DNA was then amplified (Mastercycler® pro, Eppendorf, Hamburg, Germany), and bead-purified with Agencourt RNAClean XP beads.
-
bioRxiv - Bioengineering 2019Quote: ... and 72 °C for 30s on a vapo.protect Mastercycler Pro thermocycler (Eppendorf). After clean-up with a MinElute PCR Purification Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... and PCR was performed on the Mastercycler Pro (Eppendorf, Wesseling-Berzdorf, Germany) with the following settings ...
-
bioRxiv - Microbiology 2019Quote: ... for 30 min on a Mastercycler pro S thermocycler (Eppendorf, Hamburg, Germany). We saved 50 µL of heated supernatant for direct NLuc measurement ...
-
bioRxiv - Genomics 2021Quote: ... and PCR was performed using a Mastercycler Pro (Eppendorf, Wesseling-Berzdorf, Germany) with the following thermal protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR reactions were carried out in a thermocycler (MasterCycler ProS, Eppendorf©) with the following steps ...
-
bioRxiv - Cell Biology 2019Quote: ... mRNA was converted to cDNA on an Eppendorf Mastercycler Pro (Eppendorf, Hamburg, Germany) and using Promega reagents ...
-
bioRxiv - Microbiology 2020Quote: ... Thermal cycles were carried out in a Mastercycler pro thermal cycler (Eppendorf, Hamburg, Germany) with the following program ...
-
bioRxiv - Genomics 2020Quote: ... amplicons encompassing these fusion points were PCR amplified in a Mastercycler pro thermocycler (Eppendorf) using Go-Taq Flexi DNA Polymerase (Promega) ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplification was performed using an Eppendorf Mastercycler Pro 384 thermal cycler (Eppendorf, UK) using the following programme ...
-
bioRxiv - Systems Biology 2019Quote: ... and 74.9 °C for 3 minutes in a thermocycler (Mastercycler Pro, Eppendorf, Hamberg, Germany) system as described elsewhere (Jafari et al. ...
-
bioRxiv - Microbiology 2019Quote: ... These mixtures were submitted to thermocycling in a Mastercycler Pro S (Eppendorf, Hamburg, Germany) under the following conditions ...
-
bioRxiv - Zoology 2021Quote: ... We performed the reaction using an Eppendorf Mastercycler Pro thermal cycler (Eppendorf, Hamburg, Germany) for 36 cycles with 15-s denaturation at 94 °C ...
-
bioRxiv - Systems Biology 2023Quote: ... Cultivations were carried out in DasGip 1-L stirrer-pro vessels (Eppendorf, Jülich, Germany). The working volume was 500 mL ...
-
bioRxiv - Immunology 2023Quote: ... cells were labeled with 50 nM of biotinylated human ACE2 protein (Acro Biosystems, AC2-H82E6) for 30 minutes at 4°C at 700 RPM on a shaker (Eppendorf, ThermoMixer C). The cells were subsequently washed ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The PCR program was performed using an Eppendorf Mastercycler® pro PCR system (Eppendorf, Germany). Subsequently ...
-
bioRxiv - Genomics 2020Quote: ... libraries were amplified on a PCR thermocycler for 17 cycles (Mastercycler® pro, Eppendorf, Hamburg, Germany), and purified with RNAClean XP Agencourt beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... A two-step PCR-reaction was performed on a Mastercycler Pro instrument (Eppendorf, Wesseling-Berzdorf, Germany) with the following settings ...
-
bioRxiv - Microbiology 2020Quote: ... The amplification reactions were made using specific oligonucleotides by the Mastercycler™ ProS (Eppendorf, Milano, Italy) with the following general scheme ...
-
bioRxiv - Genomics 2020Quote: ... using a plate sealer (PX1 Plate Sealer #181-4000) for droplet PCR amplification (Eppendorf Mastercycler Pro #E90030010). The following cycling conditions were used ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was performed with an annealing temperature of 59 °C and 37 cycles using Mastercycler Pro (Eppendorf).
-
bioRxiv - Microbiology 2022Quote: ... The reaction was conducted in an Eppendorf Mastercycler® pro thermal cycler (Eppendorf AG 22331 Hamburg, Germany). The PCR products were run on the 2%-TAE buffer (40mM tris ...
-
bioRxiv - Bioengineering 2023Quote: Chemostat cultivations were performed at 28°C in DasGip systems with 1 L stirrer -pro vessels (Eppendorf) as previously reported63 ...
-
bioRxiv - Microbiology 2020Quote: ... and the other half was treated at 52°C for 10 minutes in a thermocycler (Eppendorf Mastercycler ProS) before being seeded in YPD ...
-
bioRxiv - Microbiology 2020Quote: The DNA sequence (308 bp) was amplified by PCR in a Mastercycler Pro 6321 (Eppendorf AG, Hamburg, Germany). The components of the PCR reaction mix (50 μl per reaction ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were conducted using the following thermocycling parameters in a Mastercycler Pro 6321 (Eppendorf AG, Hamburg, Germany): 94 °C for 3 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... and the other half was treated at 55°C for 10 minutes in a thermocycler (Eppendorf Mastercycler ProS) before being transferred to YPD ...
-
bioRxiv - Bioengineering 2023Quote: Bioreactor fermentations at bench-top level were performed in DasGip 1-L stirrer-pro vessels (Eppendorf, Jülich, Germany) at 30 °C ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction mixture was incubated at 72 °C for 20 minutes in Mastercycler Pro 6321 (Eppendorf AG, Hamburg, Germany). End-modified PCR products were ligated into pGEM-T Easy vector (Promega ...
-
bioRxiv - Genomics 2019Quote: ... One µl of this cocktail was added to the PCR mixture and placed in a thermocycler (Eppendorf MasterCycler Pro). Thermocycling settings were as follows ...
-
bioRxiv - Immunology 2020Quote: ... Established process parameters were then scaled up to 120 L in a BioFlo Pro 150 stainless steel fermenter (Eppendorf). Phosphate depletion during the growth phase induced UF6b expression into inclusion bodies ...