Labshake search
Citations for Eppendorf :
1 - 50 of 684 citations for 8 3 5 DIMETHYL 4 METHOXYPHENYL 8 OXOOCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Cell Biology 2020Quote: 8 well chambered cover glasses (Eppendorf, 0030742036) were coated with 50 μg/mL Growth factor reduced basement membrane matrix (Matrigel® ...
-
bioRxiv - Neuroscience 2022Quote: ... Using an electronic 8-channel pipette (Eppendorf) at low dispense speed ...
-
bioRxiv - Cell Biology 2021Quote: ... or 8-well glass-bottom chambers (Eppendorf). Cells were transiently transfected by Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8% CO2 in a S41i incubator (Eppendorf) for 5 days.
-
bioRxiv - Cell Biology 2022Quote: 8-well cover-glass bottom dishes (Eppendorf, 0030742036) were plasma cleaned and immediately coated with 0.5 mg/mL Concanavalin A (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... seeded in 8-well chambered cover glass (Eppendorf 0030742036), and supplemented with a defined medium ...
-
bioRxiv - Neuroscience 2024Quote: ... samples were layered on top of the 105 µl cushion and spun at 10,000 g for 20 min at 4°C in a swing out rotor (A-8-11 swing bucket rotor, Eppendorf) to isolate CpxII bound to trans SNARE complexes (SNAREpins ...
-
bioRxiv - Systems Biology 2019Quote: ... and the bacterial cells were harvested by centrifugation (swing-out rotor A-4-44, Eppendorf; 3220 g, 8 min, 30°C). The cell pellet was resuspended in the mineral medium and centrifuged again ...
-
bioRxiv - Biochemistry 2022Quote: ... After 5 min incubation at room temperature (RT) the sample was centrifuged (8 min, RT, 180 x g, Eppendorf centrifuge 5810R) to separate proteoliposomes from the non-incorporated protein and detergent ...
-
bioRxiv - Neuroscience 2020Quote: ... Stimulations were performed with automated 8 channel pipettes (Eppendorf, Hamburg, DE) at low dispense speed on heated blocks ...
-
bioRxiv - Cell Biology 2023Quote: Cells grown on glass coverslips or 8-well chamber slides (Eppendorf) were either fixed for 10 min with 4% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were maintained between 10% and 80% confluence and kept at 37 °C with 5% CO2 (8% CO2 for VPC cells) in a humidified CO2 incubator (Eppendorf, Enfield, CT). The viable cell density (VCD ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: 15,000 cells were seeded in 8-well chamber cover glass (Eppendorf, 0030742036). After 24 h ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 8 animals were kept at each concentration in a 48-well plate (Eppendorf) and imaged in brightfield at 4x with an Invitrogen EVOS Fl Auto 2 (Thermo-Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... and overlayed with Matrigel including medium in 8 well chamber coverglass (0030742036; Eppendorf) as previously described (Debnath et al. ...
-
bioRxiv - Microbiology 2021Quote: ... were used in combination with an 8-channel 50-µL volume adaptor (Eppendorf). Each deep-well culture was used to inoculate 2 96-well flat-bottom plates as replicates for the growth curve measurements ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15.76 g EDTA (pH 8)) in 2 mL Safe-Lock tubes (Eppendorf, Hamburg, Germany). The QIAamp DNA Mini Kit (QIAGEN ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mM HEPES and seeded on confluent HFF monolayers in 8-well chamber slides (Eppendorf) at a density of 5×105 tachyzoites/well ...
-
bioRxiv - Biochemistry 2022Quote: ... and 8% CO2 in a New Brunswick S41i CO2 Incubator (New Brunswick Eppendorf, Hamburg, Germany) for 4 days and passaged twice to 0.5×106 cell/mL into a 250 mL shake flask and then into a 500 mL shake flask ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Biophysics 2021Quote: ... in particular to adjust reactions volumes to the 8- or 12-channel pipettes (Eppendorf, Hamburg, Germany), repetitive pipette HandyStep (Brand ...
-
bioRxiv - Molecular Biology 2019Quote: ... Phenol-chloroform (50:50) was added and cells were vortexed for 8 min (Eppendorf mixer 5432). The DNA was ethanol precipitated and resuspended in 40-50 µL TE (10 mM Tris ...
-
bioRxiv - Biochemistry 2023Quote: ... placed on an orbital shaker platform rotating at 125 rpm at 37 °C with 8 % CO2 (Eppendorf). On the day of transfection ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4°C for 5 minutes (Eppendorf centrifuge 5810 R, Rotor S-4-104). Cell pellets were washed with 5 mL D-PBS and centrifugation was repeated ...
-
bioRxiv - Biochemistry 2022Quote: Wholemeal flour samples were weighed (~8 mg) and transferred into a deep well plate (96/1000 μL, Eppendorf), each well containing 20 μL of DMSO and a 3 mm glass ball to improve mixing ...
-
bioRxiv - Biochemistry 2023Quote: ... 380 μL samples of 8 μM aSyn solutions were incubated in Protein LoBind polypropylene tubes (Eppendorf, ref.0030108.116) at 37 °C under quiescent conditions over 10 days in the absence and presence of a cylindrical 10 mm x 3mm Teflon stirring bar (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Immunology 2021Quote: ... Resulting cDNA was diluted 1:8 and subjected to endpoint RT-PCR using Taq DNA Polymerase (GeneDirex Inc., Taoyuan, Taiwan) in a Mastercycler Nexus (Eppendorf) or Bio-Rad T100 thermocycler ...
-
bioRxiv - Microbiology 2019Quote: ... Two hundred microliters of supernatant were transferred to tubes containing 8 µL neutralization solution (15% NH4HCO3) and dried in a Vacufuge concentrator (Eppendorf) for 30 to 45 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... The citrated blood was mixed by gentle inversion and 8 mL was transferred to a 15 mL LoBind conical tube (Eppendorf), then placed in a heated water bath set to 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... with 200 μL of 3.2 mm round beads at for 10 min at setting 8 in 1.8 mL microcentrifuge vials (Eppendorf Safe-Lock). Homogenates were transferred to a new microcentrifuge vial and briefly placed on ice for phase separation before centrifugation at 14,000 × g for 15 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... frozen leaves were extracted in 50 mM P buffer (pH 7.5) at a ratio of 1:8 (w/v) and centrifuged (Eppendorf 5417R) twice at 18,000g for 20 min ...
-
bioRxiv - Microbiology 2023Quote: ... one of the aggregated cultures was transferred to a reagent reservoir (VistaLab Technologies) and mixed 50 times with an 8-channel micropipette (Eppendorf Xplorer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pellet of clusters was resuspended in 50 μL of neutralized collagen and seeded in 8-well chambered cover glass (Eppendorf 0030742036) and supplemented with defined medium ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μL was administered to each treatment group (of 8 larvae) via oral inoculation between the mandibles using long gel loading tips (Eppendorf, UK). At each desired timepoint ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Genomics 2021Quote: ... nuclease free water and 8 ng of cDNA were run in triplicate using an automated pipetting system (epMotion M5073, Eppendorf, Hamburg, Germany), with no-template negative controls on a 384-well plate in a thermo-cycler (QuantStudio 12K Flex System ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were thawed and Urea was added to a final concentration of 8 M urea and the protein lysate was transferred to 2mL snap-cap centrifuge tubes (Eppendorf, Hamburg, Germany) with 0.1 mm zirconia beads and bead beat in a Bullet Blender (Next Advance ...
-
bioRxiv - Biochemistry 2019Quote: ... 0.5 to 1 mL of a saltwater sample or experimental mixture dissolved in ASW was dried in a speed vacuum concentrator for 8 hours (Eppendorf Concentrator Plus(R), 45°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) to remove intact cells and debris ...
-
bioRxiv - Biochemistry 2020Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, Eppendorf #A-4-81 rotor) and washed with ice-cold 50 mL Binding buffer composed of 10 mM imidazole (pH 7.4) ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS) and pelleted again (500 × g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Neuroscience 2024Quote: ... samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...