Labshake search
Citations for Eppendorf :
1 - 50 of 1140 citations for 7H Cyclopenta c pyridin 7 one 5 6 dihydro 3 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... and denatured at 85°C for 7 minutes using a ThermoMixer® C-PCR 384 (Eppendorf). After denaturation ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 5 min at 37 °C under agitation (Eppendorf, ThermoMixer C). Lobes were pipetted to promote dissociation ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Microbiology 2021Quote: ... centrifuged at 7000 RPM for 7 min at 4 °C (Eppendorf model 5804R). The supernatant was discarded ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Developmental Biology 2023Quote: ... the gRNA:Cas9 ribonucleoprotein complex solution was incubated at 37°C for 5 min and then backfilled into 3 microinjection needles using an Eppendorf GELoader tip (Eppendorf, Cat# 022351656). After loading embryos into the embryo holder which covered with 12.5 ppt of salinity water with 0.0001% of methylene blue ...
-
bioRxiv - Biochemistry 2021Quote: ... for 6 h at 37 °C at 800 rpm (shaking incubator, Eppendorf). After RNAse A was removed by centrifugation ...
-
bioRxiv - Synthetic Biology 2020Quote: ... These reactions were incubated for 0-6 h at 30°C with 500 rpm shaking (Eppendorf, Thermo Mixer C). S ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Immunology 2020Quote: ... and incubated with stirring at 500 rpm for 5 min at 85°C (Eppendorf, ThermoMixer C). Lysates were either sonicated (Sonifier 250 ...
-
bioRxiv - Biophysics 2023Quote: ... pH 5) incubated at 37°C for 20h at 300 rpm in a ThermoMixer C (Eppendorf).
-
A DNA-based optical nanosensor for in vivo imaging of acetylcholine in the peripheral nervous systembioRxiv - Bioengineering 2020Quote: The DNA scaffold was self-assembled by incubating 5 DNA oligonucleotides following a temperature gradient from 95 °C to 4 °C for 6 h in a thermocycler (Mastercycler® nexus X2, Eppendorf) in Tris-EDTA buffer (TE buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Synthetic Biology 2020Quote: ... These reactions were incubated for 3 h at 30°C with 500 rpm shaking (Thermo Mixer C, Eppendorf, Germany). Post-incubation ...
-
bioRxiv - Systems Biology 2024Quote: The flow through is first incubated at 95°C for 5 minutes (ThermoMixer C, Eppendorf, Hamburg, Germany), then the sample is allowed to cool for 5 minutes at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The mixture was incubated at 25 °C and 1,500 rpm for one hour by using a ThermoMixer (Eppendorf), and then centrifuged at 14,000 rpm for 10 min ...
-
bioRxiv - Physiology 2019Quote: ... The remaining homogenate was heated for 10 min at 70°C and spun for 3 min at top speed at 4°C (Eppendorf 5415R). The supernatant was transferred to a new tube and heated for 10 min at 70°C ...
-
bioRxiv - Plant Biology 2022Quote: ... annealing at 51 °C for 30 s and extension 72 °C for 30 s for 25 cycles by final extension 72 °C for 3 min and reaction hold at 4 °C in a thermocycler (Gradient thermocycler® Eppendorf). Amplified gene products were sequenced using the Sanger sequencing method ...
-
bioRxiv - Biophysics 2021Quote: HEK-293T cells were cultured at 37 °C and 5% CO2 (Eppendorf). Cells were plated in 60 mm dishes and transfected with 1 ug of GFP-TAX4 and 3 ug of PEI-MAX per dish ...
-
Proteome Profiling of Cerebrospinal Fluid Reveals Novel Biomarker Candidates for Parkinson’s DiseasebioRxiv - Systems Biology 2021Quote: ... samples were shaken for 5 min at 2,000 rpm (thermomixer C, Eppendorf). Peptide concentrations were measured optically at 280nm (Nanodrop 2000 ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated for 5 min at 70 °C in ThermoMixer® (Eppendorf).
-
bioRxiv - Systems Biology 2019Quote: ... and 74.9 °C for 3 minutes in a thermocycler (Mastercycler Pro, Eppendorf, Hamberg, Germany) system as described elsewhere (Jafari et al. ...
-
bioRxiv - Bioengineering 2019Quote: ... centrifuging for 5 min at 400 rcf (RT, Eppendorf 5430; Rotor: F-35-6-30), re-suspension in fresh medium and transfer to cultivation flask.
-
bioRxiv - Microbiology 2022Quote: ... were also added to each tube and incubated at 37°C for 3 h in a thermomixer (Eppendorf Thermomixer C, Hamburg, Germany). After 3 h incubation ...
-
bioRxiv - Plant Biology 2023Quote: ... The primers were annealed at 95°C for 4 min followed by 70°C for 3 min in a thermocycler (Eppendorf, Hamburg, Germany). The reaction was allowed to cool slowly to room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS) and pelleted again (500 × g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4°C for 5 minutes (Eppendorf centrifuge 5810 R, Rotor S-4-104). Cell pellets were washed with 5 mL D-PBS and centrifugation was repeated ...
-
bioRxiv - Molecular Biology 2020Quote: ... and incubated at 37°C humidified 5% CO2 incubators (Eppendorf or Thermo Scientific).
-
bioRxiv - Neuroscience 2024Quote: ... samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Plates were incubated for 5 hours at 37°C (Eppendorf Innova plate shaker) shaking at 750 rpm ...
-
bioRxiv - Systems Biology 2022Quote: ... After denaturation at 78 °C for 3 min on a flatblock thermocycler (Eppendorf, Mastercycler Nexus), samples were incubated at 45 °C for 36–48 hr in a benchtop incubator ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were kept soaked at 37 °C for up to 7 days on an orbital shaker (Excella E24, Eppendorf, Hamburg, Germany) with an agitation rate of 150 rpm ...
-
bioRxiv - Genomics 2021Quote: ... then harvested with a sterile cell scraper while at -20°C and transferred to −20 °C cold 5 mL centrifuge tubes (Eppendorf Lo-Bind). After centrifuging the cell-extracts in a 4 °C centrifuge for 5 min at 2000 x g ...
-
bioRxiv - Immunology 2021Quote: ... lifted cells were centrifuged at 15,000g for 5 minutes at 4°C (Eppendorf 5430R). Cell pellets were placed at −20°C overnight with 60 μL SDS Lysis buffer (1% SDS ...
-
bioRxiv - Biochemistry 2021Quote: ... Before every incubation RNA was preheated in SafeLock tubes (90 °C, 5’; Eppendorf, Switzerland) to ensure unfolded RNA structures ...
-
bioRxiv - Genomics 2019Quote: ... in PBS) and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Physiology 2022Quote: ... Samples were heated to 95°C for 5 min on a heating block (Eppendorf) prior to loading ...
-
bioRxiv - Genomics 2022Quote: ... incubated at 37°C for 5 minutes in a Thermoblock (ThermMixer with Thermoblock, Eppendorf) with a heated lid (ThermoTop ...
-
bioRxiv - Microbiology 2019Quote: ... Columns were placed into microcentrifuge tubes and incubated for 6 hr at 37 °C in a Thermomixer S (Eppendorf) without shaking ...