Labshake search
Citations for Eppendorf :
1 - 50 of 1180 citations for 7H 9 6 Methenofuro 2 3 f oxacycloundecin 2 7 3H dione 3a 4 5 9 10 12a hexahydro 11 methyl 3 methylene 3aR 9S 11E 12aS 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 2 μM purified TDP-43-MBP-His6 variants (WT, 5D, 12D, 12A) were set up in low binding tubes (Eppendorf) in 35 μl aggregation buffer (50 mM Tris pH 8.0 ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
Multidrug resistance plasmids commonly reprogramme expression of metabolic genes in Escherichia colibioRxiv - Microbiology 2023Quote: ... The 5 ml overnight culture was centrifuged at 8,000 rpm (Eppendorf MiniSpin F-45-12-11) for three minutes ...
-
bioRxiv - Microbiology 2024Quote: ... Each 9 mL suspension was centrifuged at 9,000 × g for 5 min (Centrifuge 5810 R, Eppendorf, Hamburg, Germany). DNA extraction was performed from the pellet using the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... and centrifuged for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) before use ...
-
bioRxiv - Cell Biology 2021Quote: ... spun at 1,000 x g at −9°C for 5 minutes then aliquoted into lo-bind 2ml centrifuge tubes (Eppendorf) and snap frozen in liquid nitrogen ...
-
bioRxiv - Bioengineering 2019Quote: ... centrifuging for 5 min at 400 rcf (RT, Eppendorf 5430; Rotor: F-35-6-30), re-suspension in fresh medium and transfer to cultivation flask.
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Biophysics 2020Quote: ... The needle was then glued to a 6×4×2 mm Neodyn magnet (QM-06×04×02-N, Magnets4you) and attached to a motorized micromanipulator (PatchMan, Eppendorf). The magnetic needle was lowered until it touched the bottom of a dummy sample dish and raised again so that it was placed above the bottom of the sample with the very tip in focus around 100 μm above the focus of the glass surface.
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Biochemistry 2019Quote: ... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Genetics 2021Quote: ... 000 rpm for 10 min at 4°C (Eppendorf 5424R with rotor Eppendorf FA-45-24-11). The supernatant was mixed with Laemmli Buffer containing β-mercaptoethanol and heated at 95°C for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... 000 rpm for 10 min at 4°C (Eppendorf 5424R with rotor Eppendorf FA-45-24-11). The supernatant was mixed with Laemmli Buffer containing β-mercaptoethanol and heated at 95°C for 10 min ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5-1 mL culture sample was harvested by centrifugation for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) and resuspended in 100-500 µL 10 mM NaOH depending on the size of the cell pellet ...
-
bioRxiv - Physiology 2019Quote: ... The remaining homogenate was heated for 10 min at 70°C and spun for 3 min at top speed at 4°C (Eppendorf 5415R). The supernatant was transferred to a new tube and heated for 10 min at 70°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were vigorously vortex-mixed for 3 min and centrifuged at 14,000 rpm for 10 min at 4 °C (Eppendorf 5804 R). The clear supernatant was then transferred to a separate vial ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2019Quote: ... The suspension was centrifuged at 500 rcf for 10 min RT (Eppendorf 5430; Rotor: F-35-6-30). These steps were repeated until a white cell pellet was obtained (indicating erythrocyte depletion) ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Cell Biology 2020Quote: ... The homogenate was further incubated on ice for 45 min before centrifugation at 21,000 g and 4°C for 2 x 10 min in an Eppendorf 5424 R benchtop centrifuge (Eppendorf). Protein content of the lysate was determined by BCA assay (Thermo Fisher) ...
-
bioRxiv - Immunology 2022Quote: ... Purified IgG was digested into F(ab’)2 with 200 μg of IdeS per 10 mg of IgG for 6 hr on a thermal mixer (Eppendorf ThermoMixer C) at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... 6 mL of the selection culture in 2 mL centrifuge tubes was pelleted at 5000 rpm for 5 minutes at 4°C in a microcentrifuge (Eppendorf, 5242R). The supernatant was removed except for the last ∼200 µL ...
-
Multidrug resistance plasmids commonly reprogramme expression of metabolic genes in Escherichia colibioRxiv - Microbiology 2023Quote: ... Transconjugant cultures were then centrifuged for five minutes at 10,000 rpm (Eppendorf MiniSpin F-45-12-11), resuspended in 1 ml PBS ...
-
bioRxiv - Bioengineering 2020Quote: ... were centrifuged at 16,873 gav for 3 min in the FA-45-18-11 fixed angle (45°) rotor of an Eppendorf model 5418 centrifuge (Eppendorf AG, Hamburg, Germany). The pellets were resuspended in 1 mL of 2.5% (v/v ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Microbiology 2019Quote: ... PMNs were sedimented for 10 min with 1000 × g at 4°C on 45° fixed-angle rotor FA-45-30-11 (Eppendorf). The supernatant was filtered by gravity through sterile PVDF 5.0 µm Millex syringe filters (Merck-Millipore) ...
-
bioRxiv - Microbiology 2019Quote: ... Liquid cultures of the inoculant (10 ml) were centrifuged at 5000 rpm in a F-34-6-38 rotor in a 5804R centrifuge (Eppendorf AG) for 10 min at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... culture samples (10 ml) were centrifuged at 5000 rpm in a F-34-6-38 rotor in a 5804R centrifuge (Eppendorf AG) for 10 min at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were spun at 10,000 g for 15 min (spin 2 in the same Eppendorf FA-45-48-11 rotor) and the resulting supernatant is the tissue lysate (TL ...
-
bioRxiv - Microbiology 2023Quote: ... A 1 mL sample was centrifuged for five minutes at 10,000 rpm (Eppendorf MiniSpin F-45-12-11), resuspended in 1 mL phosphate buffered saline (PBS ...
-
Multidrug resistance plasmids commonly reprogramme expression of metabolic genes in Escherichia colibioRxiv - Microbiology 2023Quote: ... A 1.5 ml sample was centrifuged for five minutes at 8,000 rpm (Eppendorf MiniSpin F-45-12-11), resuspended in 1 ml phosphate buffered saline (PBS) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Microbiology 2024Quote: ... ST147NDM-9 was transformed by electroporation with the resulting construct according to standard procedures using an Eporator instrument (Eppendorf). Transformants were selected on LB agar plates containing 150 μg/mL hygromycin ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Cell Biology 2020Quote: ... This isolation method included a penultimate centrifugation step in Eppendorf polypropylene conical tubes (10,000 x g for 30 min at 4°C, in Eppendorf rotor F-34-6-38) that allowed the removal/isolation of larger microvesicles ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Biochemistry 2021Quote: ... cell cultures were collected by centrifugation at 3,300 rpm for 3 min at 4°C (using Eppendorf centrifuge 5810R equipped with the A-4-62 rotor ...
-
bioRxiv - Cell Biology 2023Quote: ... the expelled homogenate was palleted by centrifugation for 3 min (at 300 g at 4°C) (Eppendorf). The pellet was discarded ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were spun down (5 min, 800 g•, 2 °C, minimal acceleration and break, Eppendorf 5810 R with swing-×bucket rotor A-4-44). The medium was discarded and the cells were dissociated in 15 mL of ice cold ACK solution (0.15 M NH4Cl ...
-
bioRxiv - Biophysics 2022Quote: ... Ltd., Kanagawa, Japan) controlled by a pneumatic microinjector (IM-11-2, Narishige, Tokyo, Japan) and a micromanipulator (Transferman NK2, Eppendorf, Hamburg, Germany) and transferred into 4 ml RNase-free water (06442-95 ...