Labshake search
Citations for Eppendorf :
1 - 50 of 1236 citations for 7 7R 7 Amino 5 azaspiro 2.4 hept 5 yl 8 chloro 6 fluoro 1 1S 2R 2 fluorocyclopropyl 1 4 dihydro 4 oxo 3 quinolinecarboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... centrifuged at 7000 RPM for 7 min at 4 °C (Eppendorf model 5804R). The supernatant was discarded ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4°C for 5 minutes (Eppendorf centrifuge 5810 R, Rotor S-4-104). Cell pellets were washed with 5 mL D-PBS and centrifugation was repeated ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Systems Biology 2023Quote: ... and incubated on ice for 1 min before pelleting with a swinging-bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Supernatant was gently removed and ∼50 µl were left behind to increase nuclei recovery ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) to remove intact cells and debris ...
-
bioRxiv - Biochemistry 2020Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, Eppendorf #A-4-81 rotor) and washed with ice-cold 50 mL Binding buffer composed of 10 mM imidazole (pH 7.4) ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS) and pelleted again (500 × g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Neuroscience 2024Quote: ... samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Cell Biology 2019Quote: ... The resin was pelleted down by centrifugation at 4°C at 1258 g for 5 min (Eppendorf #A-4-81 rotor) and washed with 25 ml ice-cold binding buffer [10 mM imidazole ...
-
bioRxiv - Biophysics 2019Quote: ... 6 mL of the selection culture in 2 mL centrifuge tubes was pelleted at 5000 rpm for 5 minutes at 4°C in a microcentrifuge (Eppendorf, 5242R). The supernatant was removed except for the last ∼200 µL ...
-
bioRxiv - Biochemistry 2022Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) and washed with ice-cold 50 mL Binding buffer composed of 10mM imidazole (pH 7.4) ...
-
bioRxiv - Immunology 2021Quote: ... lifted cells were centrifuged at 15,000g for 5 minutes at 4°C (Eppendorf 5430R). Cell pellets were placed at −20°C overnight with 60 μL SDS Lysis buffer (1% SDS ...
-
bioRxiv - Genomics 2019Quote: ... in PBS) and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Biochemistry 2020Quote: ... The solution was centrifuged at ~3220 g for 5 min (Eppendorf #A-4-81 rotor) to pellet down precipitated dyes ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS) and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf, RRID:SCR_018092). Nuclei were resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Microbiology 2019Quote: ... centrifuged at 3000 × g for 5 min at 4°C (Centrifuge 5424, Eppendorf, Hamburg, Germany), and frozen at −20°C for bacterial DNA extraction ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 intact Hydra polyps were incubated per well in a flat bottom 6-well plate (Eppendorf, Hamburg, Germany) filled with 8mL of HM or respective anesthesia ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were spun down (5 min, 800 g•, 2 °C, minimal acceleration and break, Eppendorf 5810 R with swing-×bucket rotor A-4-44). The medium was discarded and the cells were dissociated in 15 mL of ice cold ACK solution (0.15 M NH4Cl ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf) and resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Neuroscience 2020Quote: Brain nuclei were pelleted with a swinging bucket centrifuge (500 × g, 5 min, 4°C; 5920R, Eppendorf). Nuclei pellets were resuspended in 1 ml nuclei permeabilization buffer (5 % BSA ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf) and resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Genetics 2021Quote: ... nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf) and resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Systems Biology 2023Quote: ... Nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf) and washed with Wash buffer (10 mM Tris-HCL (pH 7.5) ...
-
bioRxiv - Physiology 2023Quote: ... for 1 h at 4 □ on a ThermoMixer C (Eppendorf), 350 µl of water and 250 µl of chloroform were added to the mixture to induce phase separation ...
-
bioRxiv - Biophysics 2020Quote: ... The needle was then glued to a 6×4×2 mm Neodyn magnet (QM-06×04×02-N, Magnets4you) and attached to a motorized micromanipulator (PatchMan, Eppendorf). The magnetic needle was lowered until it touched the bottom of a dummy sample dish and raised again so that it was placed above the bottom of the sample with the very tip in focus around 100 μm above the focus of the glass surface.
-
bioRxiv - Genetics 2021Quote: ... Filtered nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf) and resuspended in 1 mL Wash buffer (10mM Tris-HCL (pH 7.5) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were pelleted by centrifugation (3220 x g 5 min, Eppendorf 5810R fitted with rotor A-4-81), pellets were recombined with 5 mL pre-chilled MP medium (no carbon) ...
-
bioRxiv - Genomics 2023Quote: ... The DNA solution was pelleted by centrifugation at 6,000xg for 5 minutes at 4°C (Eppendorf Centrifuge 5425R). After removing the supernatant ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were centrifuged at 4000 rpm × 5 min at 4°C in a pre-cooled microcentrifuge (Eppendorf 5415R) and the supernatant was collected ...
-
bioRxiv - Bioengineering 2019Quote: For extract preparation each 4 mL of cell cultures from tp 48h of HDC run 1 were spun down for 10 min at 4000 g and 4 °C (Centrifuge 5804R, Rotor A-4-44, Eppendorf). Pellets were resuspended in fresh 1 mL ‘thylakoid buffer’ (50 mM HEPES-NaOH ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Immunology 2021Quote: ... The culture supernatant containing the virus was centrifuged at 4,500 g for 5 min at 4°C (Eppendorf 5810R) and stored at -80°C ...
-
bioRxiv - Genomics 2021Quote: ... 0.6 mM DTT) and pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Pulverized frozen tissue and pelleted nuclei from gentleMACS M-tubes were each split into two further aliquots ...
-
bioRxiv - Neuroscience 2020Quote: ... Isolated brain nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei pellets were resuspended in 1 ml nuclei permeabilization buffer (5 % BSA ...
-
bioRxiv - Genomics 2019Quote: ... Cells were thawed and pelleted in a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Cell pellets were resuspended in 250 μl nuclei permeabilization buffer (10 mM Tris-HCl pH 7.4 (Sigma) ...
-
bioRxiv - Genomics 2019Quote: ... Isolated brain nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei pellets were resuspended in 1 ml nuclei permeabilization buffer (5 % BSA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were put on ice for 30 min and precipitates were spun down for 5 min at 20,000 g at 4°C in a tabletop centrifuge (Eppendorf). After one wash with ice-cold acetone ...
-
bioRxiv - Cell Biology 2022Quote: ... protease and phosphatase inhibitors and PMSF (10 minutes on ice) and centrifuged at 13,300 rpm for 5 min at 4OC (Centrifuge 5810 R; rotor A-4-81; Eppendorf). The supernatant (whole cell lysates ...
-
bioRxiv - Microbiology 2023Quote: ... OD660 of 0.3-0.5 mid-log) were harvested by centrifugation (5,000 x g, 5 min at 4°C) (Eppendorf centrifuge 5430R). The supernatant was immediately discarded ...
-
bioRxiv - Synthetic Biology 2019Quote: ... in a rotating wheel (TC-7, New Brunswick/Eppendorf, Belgium). The next day ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... we centrifuged the crude lysate at 500 g for 5 min at 4°C in a microfuge (Eppendorf, model 5424R) to remove cell debris ...
-
bioRxiv - Cell Biology 2022Quote: ... Absorbance was measured at 600 nm after every 12 h intervals till 4 to 5 days using a UV-visible spectrophotometer (Eppendorf).