Labshake search
Citations for Eppendorf :
1 - 50 of 699 citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... and centrifuged for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) before use ...
-
bioRxiv - Biochemistry 2019Quote: ... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
Multidrug resistance plasmids commonly reprogramme expression of metabolic genes in Escherichia colibioRxiv - Microbiology 2023Quote: ... The 5 ml overnight culture was centrifuged at 8,000 rpm (Eppendorf MiniSpin F-45-12-11) for three minutes ...
-
bioRxiv - Plant Biology 2019Quote: ... After centrifugation (20000 g, 15 min, 4 °C, 5810R, rotor FA-45-30-11 Eppendorf, Hamburg, Germany) the supernatant was passed over a C18 cartridge (500 mg ...
-
bioRxiv - Genetics 2021Quote: ... 000 rpm for 10 min at 4°C (Eppendorf 5424R with rotor Eppendorf FA-45-24-11). The supernatant was mixed with Laemmli Buffer containing β-mercaptoethanol and heated at 95°C for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... 000 rpm for 10 min at 4°C (Eppendorf 5424R with rotor Eppendorf FA-45-24-11). The supernatant was mixed with Laemmli Buffer containing β-mercaptoethanol and heated at 95°C for 10 min ...
-
bioRxiv - Cell Biology 2023Quote: ... concentrated by centrifugation at 20,800 g for 30 min at 4 °C (Rotor F45-30-11, Eppendorf) and the resulting pellet was then used for the enrichment of glycosomal membrane proteins ...
-
bioRxiv - Biophysics 2021Quote: ... The bicelle mixture (~1 mL) was centrifuged (13,400 rpm, Eppendorf F45-12-11 rotor, 4°C, 30 sec) to remove insoluble debris and the supernatant concentrated to ~200 μL using a 0.5 mL 10 kDa MWCO centrifugal filter (Amicon ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were centrifuged at 20,800 g for 15 min at 4 °C (Rotor F45-30-11, Eppendorf), yielding cytosol enriched sample and organellar pellet ...
-
bioRxiv - Microbiology 2021Quote: ... All centrifugation steps were performed at 13806 rpm for 5 min (Centrifuge 5424, FA-45-24-11, Eppendorf). Recombinant E ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4°C for 5 minutes (Eppendorf centrifuge 5810 R, Rotor S-4-104). Cell pellets were washed with 5 mL D-PBS and centrifugation was repeated ...
-
bioRxiv - Cell Biology 2023Quote: ... The incubated sample was centrifuged at 20,800 g for 15 min at 4 °C (Rotor F45-30-11, Eppendorf), and the resulting supernatant was analyzed by immunoblotting using various antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... fractions numbered from 9 to 22 were processed by centrifugation (20,800 g for 30 min at 4 °C, Rotor F45-30-11, Eppendorf), and the resulting pellet was further resuspended in 160 μL of alkaline carbonate buffer (100 mM Na2CO3 ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5-1 mL culture sample was harvested by centrifugation for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) and resuspended in 100-500 µL 10 mM NaOH depending on the size of the cell pellet ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Microbiology 2024Quote: ... Each 9 mL suspension was centrifuged at 9,000 × g for 5 min (Centrifuge 5810 R, Eppendorf, Hamburg, Germany). DNA extraction was performed from the pellet using the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... The lysate was incubated for 30 min on a rotating wheel at 4°C and centrifuged at 16 000 g for 20 min at 4°C (Eppendorf centrifuge 5417-R, Rotor F45-30-11). The supernatant was transferred to a fresh 1.5 ml Eppendorf tube and the pellet was discarded ...
-
bioRxiv - Microbiology 2019Quote: ... PMNs were sedimented for 10 min with 1000 × g at 4°C on 45° fixed-angle rotor FA-45-30-11 (Eppendorf). The supernatant was filtered by gravity through sterile PVDF 5.0 µm Millex syringe filters (Merck-Millipore) ...
-
bioRxiv - Neuroscience 2024Quote: ... samples were layered on top of the 105 µl cushion and spun at 10,000 g for 20 min at 4°C in a swing out rotor (A-8-11 swing bucket rotor, Eppendorf) to isolate CpxII bound to trans SNARE complexes (SNAREpins ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2021Quote: ... spun at 1,000 x g at −9°C for 5 minutes then aliquoted into lo-bind 2ml centrifuge tubes (Eppendorf) and snap frozen in liquid nitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... were centrifuged at 16,873 gav for 3 min in the FA-45-18-11 fixed angle (45°) rotor of an Eppendorf model 5418 centrifuge (Eppendorf AG, Hamburg, Germany). The pellets were resuspended in 1 mL of 2.5% (v/v ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Bioengineering 2019Quote: ... centrifuging for 5 min at 400 rcf (RT, Eppendorf 5430; Rotor: F-35-6-30), re-suspension in fresh medium and transfer to cultivation flask.
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) to remove intact cells and debris ...
-
bioRxiv - Biochemistry 2021Quote: ... Unreacted dye was removed by two passages over an equilibrated Bio-spin® 6 column filled with Bio-gel P-6 media in labeling buffer and centrifuged in a tabletop centrifuge (Eppendorf 5810 R, rotor A-4-62) at 1500 rpm for 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Biochemistry 2020Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, Eppendorf #A-4-81 rotor) and washed with ice-cold 50 mL Binding buffer composed of 10 mM imidazole (pH 7.4) ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS) and pelleted again (500 × g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Neuroscience 2024Quote: ... samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Developmental Biology 2023Quote: ... were mixed in HEPES-CZB medium containing 5 μg/ml cytochalasin B (CB) and injected into the cytoplasm of fertilized eggs using a FemtoJet microinjector (Eppendorf) with constant flow settings ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Cell Biology 2019Quote: ... The resin was pelleted down by centrifugation at 4°C at 1258 g for 5 min (Eppendorf #A-4-81 rotor) and washed with 25 ml ice-cold binding buffer [10 mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) and washed with ice-cold 50 mL Binding buffer composed of 10mM imidazole (pH 7.4) ...
-
bioRxiv - Immunology 2021Quote: ... lifted cells were centrifuged at 15,000g for 5 minutes at 4°C (Eppendorf 5430R). Cell pellets were placed at −20°C overnight with 60 μL SDS Lysis buffer (1% SDS ...
-
bioRxiv - Genomics 2019Quote: ... in PBS) and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Biophysics 2020Quote: ... and centrifuged at 13,000 rpm (rotor #,FA-45-30-11, Eppendorf) for 45 minutes at 20°C to remove small aggregates and particulate matter.
-
bioRxiv - Biochemistry 2023Quote: ... previously spun down (Eppendorf 5427R, FA-45-30-11, 18000g, 10min), was manually injected onto a Superdex 200 increase 5/150 GL column (GE Healthcare) ...
-
bioRxiv - Neuroscience 2020Quote: The homogenates were pelleted at 400xg for 6 minutes at 4°C in a swing-bucket rotor centrifuge (Eppendorf). The supernatants were removed and 1 ml ice-cold DPBS (pH 7.3-7.4 ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Biochemistry 2021Quote: ... cell cultures were collected by centrifugation at 3,300 rpm for 3 min at 4°C (using Eppendorf centrifuge 5810R equipped with the A-4-62 rotor ...
-
bioRxiv - Cell Biology 2023Quote: ... the expelled homogenate was palleted by centrifugation for 3 min (at 300 g at 4°C) (Eppendorf). The pellet was discarded ...