Labshake search
Citations for Eppendorf :
1 - 50 of 1269 citations for 6H Dipyrido 3 2 b 2' 3' e 1 4 diazepin 6 one 11 ethyl 5 11 dihydro 8 2 hydroxyethyl 5 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Microbiology 2021Quote: ... and centrifuged for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) before use ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were spun at 10,000 g for 15 min (spin 2 in the same Eppendorf FA-45-48-11 rotor) and the resulting supernatant is the tissue lysate (TL ...
-
Multidrug resistance plasmids commonly reprogramme expression of metabolic genes in Escherichia colibioRxiv - Microbiology 2023Quote: ... The 5 ml overnight culture was centrifuged at 8,000 rpm (Eppendorf MiniSpin F-45-12-11) for three minutes ...
-
bioRxiv - Biophysics 2022Quote: ... Ltd., Kanagawa, Japan) controlled by a pneumatic microinjector (IM-11-2, Narishige, Tokyo, Japan) and a micromanipulator (Transferman NK2, Eppendorf, Hamburg, Germany) and transferred into 4 ml RNase-free water (06442-95 ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Neuroscience 2024Quote: ... samples were layered on top of the 105 µl cushion and spun at 10,000 g for 20 min at 4°C in a swing out rotor (A-8-11 swing bucket rotor, Eppendorf) to isolate CpxII bound to trans SNARE complexes (SNAREpins ...
-
bioRxiv - Microbiology 2021Quote: ... All centrifugation steps were performed at 13806 rpm for 5 min (Centrifuge 5424, FA-45-24-11, Eppendorf). Recombinant E ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5-1 mL culture sample was harvested by centrifugation for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) and resuspended in 100-500 µL 10 mM NaOH depending on the size of the cell pellet ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Biophysics 2019Quote: ... 6 mL of the selection culture in 2 mL centrifuge tubes was pelleted at 5000 rpm for 5 minutes at 4°C in a microcentrifuge (Eppendorf, 5242R). The supernatant was removed except for the last ∼200 µL ...
-
bioRxiv - Biophysics 2021Quote: ... The bicelle mixture (~1 mL) was centrifuged (13,400 rpm, Eppendorf F45-12-11 rotor, 4°C, 30 sec) to remove insoluble debris and the supernatant concentrated to ~200 μL using a 0.5 mL 10 kDa MWCO centrifugal filter (Amicon ...
-
bioRxiv - Bioengineering 2020Quote: ... were centrifuged at 16,873 gav for 3 min in the FA-45-18-11 fixed angle (45°) rotor of an Eppendorf model 5418 centrifuge (Eppendorf AG, Hamburg, Germany). The pellets were resuspended in 1 mL of 2.5% (v/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 million cells were added to a 5 mL DNA LoBind tube (Eppendorf, cat. no. 0030108310), centrifuged at 400 x g for 4 min ...
-
bioRxiv - Systems Biology 2023Quote: ... The samples were then distributed evenly over 2 x 5 mL reaction tubes (Eppendorf, Hamburg, Germany) and spun at 14,200 g for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were spun down (5 min, 800 g•, 2 °C, minimal acceleration and break, Eppendorf 5810 R with swing-×bucket rotor A-4-44). The medium was discarded and the cells were dissociated in 15 mL of ice cold ACK solution (0.15 M NH4Cl ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Biophysics 2020Quote: ... The needle was then glued to a 6×4×2 mm Neodyn magnet (QM-06×04×02-N, Magnets4you) and attached to a motorized micromanipulator (PatchMan, Eppendorf). The magnetic needle was lowered until it touched the bottom of a dummy sample dish and raised again so that it was placed above the bottom of the sample with the very tip in focus around 100 μm above the focus of the glass surface.
-
bioRxiv - Plant Biology 2019Quote: ... After centrifugation (20000 g, 15 min, 4 °C, 5810R, rotor FA-45-30-11 Eppendorf, Hamburg, Germany) the supernatant was passed over a C18 cartridge (500 mg ...
-
bioRxiv - Genetics 2021Quote: ... 000 rpm for 10 min at 4°C (Eppendorf 5424R with rotor Eppendorf FA-45-24-11). The supernatant was mixed with Laemmli Buffer containing β-mercaptoethanol and heated at 95°C for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... 000 rpm for 10 min at 4°C (Eppendorf 5424R with rotor Eppendorf FA-45-24-11). The supernatant was mixed with Laemmli Buffer containing β-mercaptoethanol and heated at 95°C for 10 min ...
-
bioRxiv - Cell Biology 2023Quote: ... concentrated by centrifugation at 20,800 g for 30 min at 4 °C (Rotor F45-30-11, Eppendorf) and the resulting pellet was then used for the enrichment of glycosomal membrane proteins ...
-
bioRxiv - Paleontology 2020Quote: ... 5 mg of bone powder was transferred to a 2 mL Eppendorf® tube (Eppendorf; Westbury, NY, USA) and 1 mL of demineralizing solution (5% trifluoroacetic acid (TFA ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were centrifuged at 20,800 g for 15 min at 4 °C (Rotor F45-30-11, Eppendorf), yielding cytosol enriched sample and organellar pellet ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15.76 g EDTA (pH 8)) in 2 mL Safe-Lock tubes (Eppendorf, Hamburg, Germany). The QIAamp DNA Mini Kit (QIAGEN ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Microbiology 2022Quote: ... The tip of one swab was broken off into a 2 ml tube (BioPur, Eppendorf) and snap frozen in dry-ice and stored at −80°C ...
-
bioRxiv - Cell Biology 2023Quote: ... The incubated sample was centrifuged at 20,800 g for 15 min at 4 °C (Rotor F45-30-11, Eppendorf), and the resulting supernatant was analyzed by immunoblotting using various antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... fractions numbered from 9 to 22 were processed by centrifugation (20,800 g for 30 min at 4 °C, Rotor F45-30-11, Eppendorf), and the resulting pellet was further resuspended in 160 μL of alkaline carbonate buffer (100 mM Na2CO3 ...
-
bioRxiv - Biophysics 2020Quote: ... and centrifuged at 13,000 rpm (rotor #,FA-45-30-11, Eppendorf) for 45 minutes at 20°C to remove small aggregates and particulate matter.
-
bioRxiv - Biochemistry 2023Quote: ... previously spun down (Eppendorf 5427R, FA-45-30-11, 18000g, 10min), was manually injected onto a Superdex 200 increase 5/150 GL column (GE Healthcare) ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Cell Biology 2020Quote: Germinal vesicle intact oocytes were microinjected with ~5 pL of cRNAs in M2 medium containing milrinone at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf) and picoinjector (Medical Systems Corp.) ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were recovered in 1 mL YPD (1% yeast extract, 2% Bacto peptone, 2% D-glucose) at 30°C in a ThermoMixer C (Eppendorf, Hamburg, Germany) for 3 hours (200 RPM ...
-
bioRxiv - Biochemistry 2019Quote: ... Dilutions (1:2) were performed using EP Motion (Eppendorf) and transferred to cells using the Tecan Freedom Evo ...
-
bioRxiv - Microbiology 2019Quote: ... PMNs were sedimented for 10 min with 1000 × g at 4°C on 45° fixed-angle rotor FA-45-30-11 (Eppendorf). The supernatant was filtered by gravity through sterile PVDF 5.0 µm Millex syringe filters (Merck-Millipore) ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Molecular Biology 2022Quote: ... for 20 minutes (Eppendorf centrifuge 5424 R, Rotor FA-45-24-11). A portion of each lysate (60-100 µL ...
-
bioRxiv - Microbiology 2021Quote: ... centrifuged at 11 000 rpm for 20 min (5430R, Eppendorf, Hamburg, Germany) to pellet cells ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were diluted to 2 x 107 cells per mL and 50 µL of each sample was added to 5 mL tubes (Eppendorf, Hamburg, DE), to constitute 1 million cells per flow sample.
-
bioRxiv - Microbiology 2023Quote: ... A 1 mL sample was centrifuged for five minutes at 10,000 rpm (Eppendorf MiniSpin F-45-12-11), resuspended in 1 mL phosphate buffered saline (PBS ...
-
bioRxiv - Biophysics 2022Quote: ... The lysate was incubated for 30 min on a rotating wheel at 4°C and centrifuged at 16 000 g for 20 min at 4°C (Eppendorf centrifuge 5417-R, Rotor F45-30-11). The supernatant was transferred to a fresh 1.5 ml Eppendorf tube and the pellet was discarded ...