Labshake search
Citations for Eppendorf :
1 - 50 of 932 citations for 6 Chloro 5 6 dihydroimidazo 1 5 a pyrido 3 2 e pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 intact Hydra polyps were incubated per well in a flat bottom 6-well plate (Eppendorf, Hamburg, Germany) filled with 8mL of HM or respective anesthesia ...
-
bioRxiv - Bioengineering 2019Quote: ... centrifuging for 5 min at 400 rcf (RT, Eppendorf 5430; Rotor: F-35-6-30), re-suspension in fresh medium and transfer to cultivation flask.
-
bioRxiv - Cell Biology 2019Quote: ... HeLa SS6 or 1.E cells were seeded into 35 mm tissue culture dishes or 6 well tissue culture plates (Eppendorf) with or without pre-cleaned ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 20 mL of the enrichment was transferred to 5 L NMS medium in a 6-L fermenter controlled with a BioFlo® 120 Bioprocess Control Station (Eppendorf, Hamburg, Germany). Gas stream carrying a relatively low CH4 concentration (0.5% v/v in air ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 6–6 droplets for the remaining days) were inoculated into 150-mm Petri dishes (Eppendorf, Hamburg, Germany), and the cells were allowed to attach to the surface for 2 h in a CO2 incubator (5% CO2 and 90% humidity) ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Cell Biology 2022Quote: For esiRNA transfection 35,000 U2OS cells were seeded in 2 ml medium in 6-well plates (Eppendorf) the evening before transfection ...
-
bioRxiv - Biophysics 2020Quote: ... The needle was then glued to a 6×4×2 mm Neodyn magnet (QM-06×04×02-N, Magnets4you) and attached to a motorized micromanipulator (PatchMan, Eppendorf). The magnetic needle was lowered until it touched the bottom of a dummy sample dish and raised again so that it was placed above the bottom of the sample with the very tip in focus around 100 μm above the focus of the glass surface.
-
bioRxiv - Bioengineering 2020Quote: The cjFFs were transfected at P4-6 with Multiporator (Eppendorf) according to the protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... with an fixed angled-rotor (FA-45-6-30, Eppendorf) and the virus pellet was resuspended in OPC-Sato medium for 1 hour at 4°C on a shaker ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 % CO2 (Eppendorf). Jurkat CD4-KO cells were derived from wild-type Jurkat T cells (clone E6 ...
-
bioRxiv - Biophysics 2020Quote: 5) Centrifuge (Eppendorf, 5810R)
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Purified IgG was digested into F(ab’)2 with 200 μg of IdeS per 10 mg of IgG for 6 hr on a thermal mixer (Eppendorf ThermoMixer C) at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Unreacted dye was removed by two passages over an equilibrated Bio-spin® 6 column filled with Bio-gel P-6 media in labeling buffer and centrifuged in a tabletop centrifuge (Eppendorf 5810 R, rotor A-4-62) at 1500 rpm for 3 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 million cells were added to a 5 mL DNA LoBind tube (Eppendorf, cat. no. 0030108310), centrifuged at 400 x g for 4 min ...
-
bioRxiv - Systems Biology 2023Quote: ... The samples were then distributed evenly over 2 x 5 mL reaction tubes (Eppendorf, Hamburg, Germany) and spun at 14,200 g for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL droplets were inoculated into 6-well plates (Eppendorf, Hamburg, Germany). After allowing the cells to adhere to the surface for 2 hours in a CO2 incubator (37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... for 6 h at 37 °C at 800 rpm (shaking incubator, Eppendorf). After RNAse A was removed by centrifugation ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 % CO2 using microloaders (Eppendorf). Slices were placed into the incubation chambers one at a time (minimum volume 1.5 ml to cover raised grid) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% P/S on a magnetic separator cells were cultured in fibronectin-coated 6-well plates (Eppendorf, Hamburg, Germany) in DMEM/F-12 ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Developmental Biology 2023Quote: ... Organoids were transferred to a 6 cm ultra-low-attachment dish (Eppendorf, 30701011) containing Tyrode’s solution (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... incubated (1 h) and centrifuged (Eppendorf centrifuge R5810, 4000 rpm for 5 min) for β-galactosidase activity quantification ...
-
bioRxiv - Genomics 2024Quote: ... 1 mL of well-grown culture was centrifuged (5 min, 2040 g; Eppendorf) and the superfluous medium was removed by pipetting ...
-
bioRxiv - Cell Biology 2023Quote: ... transferred in 5 ml tubes (Eppendorf) and 480 μl Triton-X-100 (2% [vol/vol] final concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Paleontology 2020Quote: ... 5 mg of bone powder was transferred to a 2 mL Eppendorf® tube (Eppendorf; Westbury, NY, USA) and 1 mL of demineralizing solution (5% trifluoroacetic acid (TFA ...
-
bioRxiv - Cell Biology 2020Quote: ... or western blot analysis (200 000 cells in 6-well plates (Eppendorf, cat# 0030720113) were left to attach for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then seeded in a Matrigel-coated 6-well plate (Eppendorf, cat # 0030720113) to 2.5×106 cells/well with dual SMAD inhibitor media supplemented with Dorsomorphin (1μM ...
-
bioRxiv - Immunology 2020Quote: Using 5 mL lo-bind tubes (Eppendorf), 960 μL of ice-cold methanol was added to ~1 mL of protein supernatant and vortexed briefly before subsequent addition of 160 μL of ice-cold chloroform and thorough mixing ...
-
bioRxiv - Neuroscience 2024Quote: ... placed in 5-ml tubes (Eppendorf, 0030119452) and dehydrated 1h in each methanol baths (50% ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were seeded into 6-well or 12-well polystyrene coated plates (Eppendorf; EP0030720130, EP0030721012) at a density of 0.3 x 106 cells mL−1 or 0.1 x 106 cells mL−1 ...
-
bioRxiv - Bioengineering 2022Quote: ... Subsequent washes were performed at a volume of 5 mL in 5 mL Eppendorf tubes (Cat. No. 0030122321, Eppendorf) and pelleted with a compatible microcentrifuge (MC-24™ Touch ...
-
bioRxiv - Developmental Biology 2023Quote: ... the gRNA:Cas9 ribonucleoprotein complex solution was incubated at 37°C for 5 min and then backfilled into 3 microinjection needles using an Eppendorf GELoader tip (Eppendorf, Cat# 022351656). After loading embryos into the embryo holder which covered with 12.5 ppt of salinity water with 0.0001% of methylene blue ...
-
bioRxiv - Microbiology 2022Quote: ... and incubated for 1 h before centrifugation (Eppendorf centrifuge R5810, 4000 rpm for 5 min), followed by quantification of β-galactosidase activity.
-
bioRxiv - Cell Biology 2020Quote: Germinal vesicle intact oocytes were microinjected with ~5 pL of cRNAs in M2 medium containing milrinone at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf) and picoinjector (Medical Systems Corp.) ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Microbiology 2019Quote: ... in a 5 mL tube (Eppendorf, Hamburg, Germany). Tubes were kept as cold as possible while in the field (usually for less than 8 h ...
-
bioRxiv - Developmental Biology 2019Quote: ... at 5% CO2 (Eppendorf® New Brunswick Galaxy170S). Media was changed every day and cells were passaged upon reaching 80% confluence ...
-
bioRxiv - Cell Biology 2019Quote: ... shaked for 5 min on a thermomixer (Eppendorf) at room temperature and centrifuged for 20 min at 4°C full speed ...
-
bioRxiv - Microbiology 2023Quote: ... vortexed for 5 min and then centrifuged (Eppendorf Centrifuge model 5810 R ...