Labshake search
Citations for Eppendorf :
1 - 50 of 128 citations for 5α CHOLESTAN 3 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and a volume corresponding to an OD600nm of one (109 cells) was pelleted at 14,000 x g for one minute (Eppendorf MiniSpin). 20 µl of supernatant was mixed with 50 µl BioLux Gaussia Luciferase Assay substrate (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... tubes were centrifuged one minute at 2,500 x g (Eppendorf MiniSpin) before incubation at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and coinjected into one-cell stage embryos using a microinjector (Eppendorf). Amplification of the target regions for genotyping was performed using primer pairs 5‘-AGGCACGTATCCTCTTCTGG-3‘ and 3‘-CAAGACGACACATCAGCACA-5‘ for exon 1 in inpp5e ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Microbiology 2021Quote: ... the plates were centrifuged at 1,000 x g for one minute (Eppendorf Centrifuge 5810R with a A-2-DWP-AT plate rotor ...
-
bioRxiv - Microbiology 2020Quote: ... One hundred microliters of sample were loaded into disposable cuvette (Eppendorf 952010077) and analyzed by DLS ...
-
bioRxiv - Genomics 2023Quote: ... One microliter of each cDNA sample was used for TaqMan PCR (Eppendorf RealPlex Mastercycler and Applied Biosystems QuantStudio 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... One single intravitreal injection was carried out using a FemtoJet express microinjector (Eppendorf).
-
bioRxiv - Developmental Biology 2020Quote: ... and transferred to Eppendorf tubes (neural tube tissue from one embryo per Eppendorf) that were snap frozen ...
-
bioRxiv - Neuroscience 2022Quote: ... was injected into one lateral hemisphere of E15.5 embryos using FemtoJet 4i (Eppendorf). Embryonic neural progenitor cells were labelled using the electroporator (ECM 830 ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Microbiology 2020Quote: ... One milliliter aliquots of each culture were then centrifuged at 15,000 rpm (Eppendorf Centrifuge 5424) for 1 min and the pellets were resuspended in 1 mL 10% marine broth diluted with sterile seawater ...
-
bioRxiv - Neuroscience 2022Quote: ... Later they were put in 2ml Eppendorf in 70% ethanol (60 flies in one Eppendorf). Flies were first crushed in 150ul of 70% ethanol and then 150ul 70% ethanol was added to crush them more ...
-
bioRxiv - Microbiology 2022Quote: ... The tip of one swab was broken off into a 2 ml tube (BioPur, Eppendorf) and snap frozen in dry-ice and stored at −80°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Microinjection was carried out in medaka embryos at the one-cell stage using FemtoJet (Eppendorf) and InjectMan NI 2 (Eppendorf) ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 microglia were sorted and immediately collected in one well of a 96-well plate (Eppendorf) filled with 5 µl cold lysis buffer from the NEBNext® Single Cell/Low Input cDNA Synthesis & Amplification Module (New England Bio Labs ...
-
bioRxiv - Cell Biology 2023Quote: ... The isolated flagella were pelleted one final time at ∼20000xg (14000rpm in an Eppendorf 5417C centrifuge) for 20 min at 4 C ...
-
bioRxiv - Developmental Biology 2022Quote: ... were injected into one of the paired olfactory cavities through fine glass capillaries using a pressurized (Eppendorf FemtoJet Express ...
-
bioRxiv - Molecular Biology 2022Quote: One ml of SF per sample was spun in a benchtop centrifuge (Eppendorf non-refrigerated centrifuge 5420) at rpm1400rpm for 10 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... We have determined that one critical parameter in this process is the use of low-retention 1.5 ml microcentrifuge tubes (e.g., Eppendorf DNA LoBind tubes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The mixture was incubated at 25 °C and 1,500 rpm for one hour by using a ThermoMixer (Eppendorf), and then centrifuged at 14,000 rpm for 10 min ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Genomics 2019Quote: ... One µl of this cocktail was added to the PCR mixture and placed in a thermocycler (Eppendorf MasterCycler Pro). Thermocycling settings were as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... One milliliter of the supernatant was then transferred to new tubes after centrifugation at 14,000 rpm (Eppendorf K-5418R). A total of 1.2 mL of a 10 mM sodium periodate solution (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... Injections were performed in less than one-day-old female pupae using a microinjector (Fentojet® Express, Eppendorf®) and a micromanipulator (Narishige®) ...
-
bioRxiv - Cell Biology 2021Quote: ... Frozen cell pellets were resuspended in hypotonic buffer and homogenized using a disposable plastic pestle (As One Corp., Osaka, Japan) with matched Safe-Lock tubes (Eppendorf). The detailed procedure is summarized in Fig ...
-
bioRxiv - Genomics 2021Quote: ... live cell was index-sorted into one 96-well quadrant of a 384-well plate (Eppendorf lo-bind twin-tec) containing a mixture of DPBS and shearing master mix at a final volume of 2.14 μL using a MoFlo Astrios cell sorter running Summit v6.3 (Beckman Coulter) ...
-
bioRxiv - Bioengineering 2019Quote: ... One hundred nanograms of cDNA were amplified in duplicates in each 40-cycle reaction using a Mastercycler (Eppendorf, Hauppauge, NY) with annealing temperature set at 60°C ...
-
bioRxiv - Genetics 2021Quote: ... Oxford Nanopore Technologies, SQK-LSK109. At this step, the resuspendend beads from the three samples were pooled into one Eppendorf tube ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 nl of the mix was injected into the cell of a one-cell stage embryo using a FemtoJet Microinjector (Eppendorf).
-
bioRxiv - Genomics 2023Quote: ... Single mantamonad cells were then isolated from one of the enriched cultures with an Eppendorf PatchManNP2 micromanipulator using a 65 µm VacuTip microcapillary (Eppendorf) and a Leica Dlll3000 B inverted microscope ...
-
bioRxiv - Genetics 2023Quote: Zebrafish embryos were collected and injected as previously described (Rosen et al., 2009) at one-cell stage using a FemtoJet Injector (Eppendorf) or PV820 injector (WPI ...
-
bioRxiv - Microbiology 2024Quote: ... A volume of 1 nL containing 500 ng/μL mRNA coding for each of these proteins was injected into one-cell stage embryos using the FemtoJet 4i microinjector (Eppendorf). H2O was used as reference control.
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Systems Biology 2020Quote: ... 5 Ml/well of the product from each 1st PCR plate was pooled into one specific well of the collection plate (Deepwell plate 96/500 μ!, Eppendorf; each well containing all 96 samples from one 1st PCR plate) ...
-
bioRxiv - Plant Biology 2022Quote: ... cheesecloth in four layers were used to filter the mixtures and centrifuged for one hour at 3000 rpm in a centrifuge (5804/5804 R, Eppendorf, Germany). A single layer of Whatman No ...
-
bioRxiv - Genetics 2022Quote: ... solution containing capped mRNAs (green fluorescence protein [GFP]mRNA or mutant pls1 mRNA or wildtype pls1 mRNA) was injected into the zebrafish embryos (one-cell stage) using FemtoJet 4i (Eppendorf, Germany). Embryos at different developmental stages were preserved and collected for subsequent experiments
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... containing 100 ng/μL of Cas9 mRNA and 25 ng/μL of sgRNA was injected into Japanese medaka 39 embryos at the one-cell stage using Femto Jet (Eppendorf, Hamburg, Germany) and GD-1 needles (Narishige ...
-
bioRxiv - Genetics 2020Quote: ... Approximately 3 nl of RNP complex were injected into the animal pole of one-cell stage embryos (50-250 embryos/experiment) using a Femtojet 5247 microinjector (Eppendorf, Hamburg, Germany) under a Nikon DS-Ri2 stereomicroscope ...
-
bioRxiv - Developmental Biology 2022Quote: ... were injected into one of the paired olfactory cavities through fine glass capillaries using a pressurized (Eppendorf FemtoJet Express; Eppendorf, Hamburg, Germany) or hydraulic (IM-6 ...
-
bioRxiv - Genetics 2023Quote: ... we microinjected ∼1 nL microinjection mix into each embryo (either the single cell or one of the dividing cells) using a FemtoJet 4i microinjector (Eppendorf, Hamburg, Germany) (Supplementary Figure S1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2019Quote: ... Loaded microfluidic chambers were centrifuged 3 min at 1000 rcf (Eppendorf centrifuge 5430R) to maximize cell adhesion.
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
High resolution, serial imaging of early mouse and human liver bud morphogenesis in three dimensionsbioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 table top centrifuge) and resuspended ...
-
bioRxiv - Genomics 2020Quote: ... 3 ml of each bacterial suspension were centrifuged at 6,000 × g (Eppendorf, Westbury, NY) for 2 mins ...