Labshake search
Citations for Eppendorf :
1 - 50 of 1023 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 µl of the samples or blanks were pipetted on the 96 well-plate based kit containing calibrators and internal standards using an automated liquid handling station (epMotion 5075, Eppendorf) and subsequently dried under a nitrogen stream using a positive pressure manifold (Waters) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 µl of the samples or blanks were pipetted on the 96 well-plate-based kit containing calibrators and internal standards using an automated liquid handling station (epMotion 5075, Eppendorf) and subsequently dried under a nitrogen stream using a positive pressure manifold (Waters) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Plates were incubated for 5 hours at 37°C (Eppendorf Innova plate shaker) shaking at 750 rpm ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... 96 deep-well plates (2-mL) were obtained from Eppendorf (Hamburg, Germany). Black Polystyrene Universal Microplate Lid was sourced from Corning (Corning ...
-
bioRxiv - Microbiology 2020Quote: ... The overnight culture was diluted in Mueller Hinton Broth (MHB) based on the OD600 to obtain 5 × 105 CFU/mL using a BioPhotometer D30 (Eppendorf, Hauppauge, NY). An OD600 of 1 was assumed to be equal to 8 × 108 CFU/mL.
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... topotecan-resistant Y79 (5×103) were plated into 96-well plates (Eppendorf, Sigma Aldrich) and incubated overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Systems Biology 2022Quote: ... The plate was then centrifuged at 1,000 rpm for 5 min using a centrifuge (Eppendorf, 5810R) that was precooled at the desired temperature (e.g ...
-
bioRxiv - Microbiology 2020Quote: ... The plates were then spun at 260g for 5 min at room temperature (Eppendorf 5810R centrifuge) and incubated at 33°C ...
-
bioRxiv - Bioengineering 2022Quote: ... Cell- and drug-containing plates were then centrifuged for 5 minutes at 135 x g (Eppendorf 5810R), then incubated for 72 hours at 37°C in 5% CO2 humidified atmosphere with gas permeable plate sealing film (VWR) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Around 5 x 105 or fewer cells were used for staining (96 well plate or Eppendorf tubes). Cells were centrifuged at 1500 rpm for 5 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: SK-N-BE(2) cells (6000-8000 cells/well) were seeded in 24-well plates (Eppendorf) overnight and prior to treatment with retinoic acid (RA)(10 μM ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The sender strains deep-well plate was then centrifuged at 4000 rpm for 5 minutes (Centrifuge Eppendorf 5810R) and the supernatants were transferred by pipetting in a new 2 mL deep-well plate ...
-
bioRxiv - Immunology 2022Quote: ... 384 wells (the entire plate, including negative controls) were pooled in a single 2 ml tube (Eppendorf). Purification of cDNA was performed by adding 400 μl of cDNA in a 1:1 ratio with SeraMag SpeedBeads in 19% w/v PEG 8,000 in a 1.5 ml LoBind tube ...
-
bioRxiv - Cell Biology 2022Quote: For esiRNA transfection 35,000 U2OS cells were seeded in 2 ml medium in 6-well plates (Eppendorf) the evening before transfection ...
-
bioRxiv - Genomics 2021Quote: ... with detection on the Realplex system (Eppendorf). Relative gene quantification was based on the comparative threshold cycle method (2-ΔΔCt ...
-
bioRxiv - Genomics 2020Quote: ... with detection on the Realplex system (Eppendorf). Relative gene expression quantification was based on the comparative threshold cycle method (2–ΔΔCt ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Neuroscience 2023Quote: ... They were then resuspended to a concentration of ∼800-3000 nuclei per uL across 3-4 x twin.tec™ 96 Well LoBind PCR Plates (Eppendorf, 0030129512) in NSB ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 million cells were added to a 5 mL DNA LoBind tube (Eppendorf, cat. no. 0030108310), centrifuged at 400 x g for 4 min ...
-
bioRxiv - Systems Biology 2023Quote: ... The samples were then distributed evenly over 2 x 5 mL reaction tubes (Eppendorf, Hamburg, Germany) and spun at 14,200 g for 15 min ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 intact Hydra polyps were incubated per well in a flat bottom 6-well plate (Eppendorf, Hamburg, Germany) filled with 8mL of HM or respective anesthesia ...
-
bioRxiv - Immunology 2019Quote: 1000 cells of CD4+ cells were sorted directly into 5 ul of TCL buffer (Qiagene, Cat#1031576) in skirted Eppendorf 96-well twin.tec PCR plate (Eppendorf). Smart-seq2 modified from a published method [13] was carried out at Broad Technology Labs ...
-
bioRxiv - Cell Biology 2022Quote: U-2 OS cells were grown in 24-well glass bottom plates (170 µm coverglass bottom; Eppendorf #0030741021) coated with poly-l-lysine and treated with 200 µM oleate-BSA complex for 24 hr ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μM final test concentration) were mixed (reaction mix) and transferred into a white 96 well plate (Eppendorf Twin-Tec ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Physiology 2020Quote: ... on an iCycler Real-Time Detection System (Eppendorf). The mRNA levels were normalized to 18S.
-
bioRxiv - Genomics 2019Quote: ... Deep red-) Single cells were sorted into 5 ul of RLT 1%β-Mercaptoethanol in a 96 well plate (Eppendorf) and frozen at −80°C.
-
bioRxiv - Immunology 2020Quote: ... 293T-hACE2-FFLuc-GFP-RBD cells were transfected with 0.25 μg of SARS-CoV-2-RBD plasmid and 0.25 μg of pHAGE-FFLuc-GFP each well in a 24-well plate (Eppendorf) for 48 hours at 37°C under 5% (v/v ...
-
Phosphoproteomics of cellular mechanosensing reveals NFATC4 as a regulator of myofibroblast activitybioRxiv - Systems Biology 2023Quote: ... cleared by centrifugation and transferred to a clean 2 ml 96-well deep-well plate (DWP, Eppendorf, Hamburg, Germany). TiO2 beads (Titansphere® Phos-TiO Bulk 10 µm ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Biochemistry 2019Quote: ... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Paleontology 2020Quote: ... 5 mg of bone powder was transferred to a 2 mL Eppendorf® tube (Eppendorf; Westbury, NY, USA) and 1 mL of demineralizing solution (5% trifluoroacetic acid (TFA ...
-
bioRxiv - Microbiology 2021Quote: ... The surrounding SCFM was directly transferred to individual sterile 2 ml DNA lo-bind tubes from the 24-well plate (Eppendorf).
-
bioRxiv - Immunology 2021Quote: ... 293T-hACE2 cells were transfected with 0.5 μg of SARS-CoV-2-RBD plasmid (a gift from Dr. Abraham Pinter) in each well in a 24-well plate (Eppendorf) for 48 hours at 37°C under 5% (v/v ...
-
bioRxiv - Genomics 2020Quote: ... was used to pool the whole 384-well plate containing the barcoded cDNA into a single 2 ml DNA LoBind tubes (Eppendorf) and cleaned up using Sera-Mag Select beads (GE Healthcare ...
-
bioRxiv - Immunology 2020Quote: ... 293T-hACE2 cells were transfected with 0.5 μg of SARS-CoV-2-RBD plasmid (a gift from Dr. Abraham Pinter) each well in a 24-well plate (Eppendorf) for 48 hours at 37°C under 5% (v/v ...
-
bioRxiv - Cell Biology 2023Quote: ... The flow rate was 0.2 ml/min and 48 × 100 μl fractions were collected in a low-protein binding 96-deep-well plate (Eppendorf) at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... the gRNA:Cas9 ribonucleoprotein complex solution was incubated at 37°C for 5 min and then backfilled into 3 microinjection needles using an Eppendorf GELoader tip (Eppendorf, Cat# 022351656). After loading embryos into the embryo holder which covered with 12.5 ppt of salinity water with 0.0001% of methylene blue ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Genetics 2022Quote: ... Yeast strains were manually inoculated into 400 µL of liquid SC -lys medium with G418 and grown overnight in 2 mL 96 well plates at 30.0 °C with 1000 rpm mixing using a MixMate (Eppendorf, Hamburg, Germany). The following morning ...