Labshake search
Citations for Eppendorf :
3051 - 3100 of 4996 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and reactions were placed in the dark on a thermal mixer (Eppendorf) set to 37°C and shaking at 850 r.p.m ...
-
bioRxiv - Biophysics 2021Quote: ... Microinjections were done using a Femtojet microinjector (Eppendorf, Hamburg, Germany) and a micromanipulator with pulled microcapillary pipettes ...
-
bioRxiv - Cancer Biology 2021Quote: ... 30-70 kDa lane portions were excised into 2×2 mm cubes and transferred to Protein Lo-Bind tubes (Eppendorf). Excised gels were partitioned into tubes ...
-
bioRxiv - Cell Biology 2021Quote: ... and washed three times in Ni-binding buffer in 2 mL Protein Lo Bind Tubes (Eppendorf). Bead conjugated 6xHis-SNAP-Rab5B was incubated for 15 minutes in room temperature with gentle agitation ...
-
bioRxiv - Cell Biology 2021Quote: ... as previously stated) they were transferred (three-quarters of a T25 flask/well) to non-adherent 24-well plates (Eppendorf, Hamburg, Germany, Cat #0030 722.019). Vero cells were plated in 24-well plates and then exposed to ZIKV at an MOI of 1 ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant was syringe filtered into an HPLC vial (Eppendorf FA-45-24-11) using a 0.22 μm PVDF filter ...
-
bioRxiv - Cell Biology 2021Quote: ... the beads were transferred to a pre-cooled 1.5 mL tube (Eppendorf), resuspended in 2 x SDS-containing sample buffer and boiled for 10 min at 95 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The extract was centrifuged at 14k for 15 min at 4°C (Eppendorf, 5804R). Supernatant was collected and divided equally in two parts ...
-
bioRxiv - Cell Biology 2021Quote: ... and then spun at 4,614 x g for 12.5 min at 18°C in a centrifuge (Eppendorf 5810R). Cushion was removed and the coverslips were washed with TBS-TX twice for 5 minutes each ...
-
bioRxiv - Bioengineering 2021Quote: ... the STR (DASGIP® Parallel Bioreactor System, Eppendorf AG, 76DG04CCBB, working volume 700 mL) used for DIP production was equipped with one inclined blade impeller (three blades ...
-
bioRxiv - Physiology 2021Quote: ... Skin-electrode contact was made by inserting conductive gel (Sonogel, Bad Camberg, Germany) into the electrode cavities with a mechanical pipette (Eppendorf, Hamburg, Germany) as reported previously (5) ...
-
bioRxiv - Physiology 2021Quote: ... RNA concentration and quality were verified using a Bio Photometer (Eppendorf, Hamburg, Germany). The PrimeScript RT reagent kit (Takara Bio ...
-
bioRxiv - Biochemistry 2021Quote: ... Before every incubation RNA was preheated in SafeLock tubes (90 °C, 5’; Eppendorf, Switzerland) to ensure unfolded RNA structures ...
-
bioRxiv - Physiology 2021Quote: ... These were then incubated at 70°C at 1400 rpm for 2 hours on a heat shaker (Eppendorf) and spun at 2500 x g for 5 min ...
-
bioRxiv - Plant Biology 2021Quote: ... Three seeds were sown in the center of each rhizotron using a p200 pipette (Eppendorf) and a unique barcode was placed on the rubber U-channel ...
-
bioRxiv - Plant Biology 2021Quote: ... The cell extract was collected on ice and larger particles were separated by sequentially centrifuged at 1,000 xg for 10 min (Eppendorf 5810R), 3,000 xg for 20 min ...
-
bioRxiv - Plant Biology 2021Quote: ... The infiltrated leaves were drained carefully on filter paper and centrifuged (Eppendorf 5810R) in 30 ml syringes placed in 50 ml falcon tubes for 20 min at 700 g and 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by centrifugation at 10,000 g for 30 min at 4°C (Eppendorf 5417R). The supernatant was then diluted to 10 ml with VIB and centrifuged for 1 h at 48,000 g at 4°C (Beckmann J2-21M/E) ...
-
bioRxiv - Plant Biology 2021Quote: ... The OD600 was measured using a spectrophotometer (Biophotometer, Eppendorf) and adjusted to 1 by adding infiltration media.
-
bioRxiv - Plant Biology 2021Quote: ... and after staining with Coomassie brilliant Blue G- ds were excised from the gel and transferred to LoBind tubes (Eppendorf). For in-gel digestion ...
-
bioRxiv - Biochemistry 2021Quote: ... 33 mg of MFC tissue stored at −80°C was transferred to 1.5 mL LoBind Eppendorf tubes (Eppendorf, Cat# 022431081) and combined with 0.5 mL homogenization buffer consisting of 8 M urea ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated in a Thermomixer compact (Eppendorf AG, Hamburg, Germany) using a rotation speed of 1,300 rpm for 10 min ...
-
bioRxiv - Biochemistry 2021Quote: ... and centrifuged prior to loading into a 96 well plate (Eppendorf, Hamburg, Germany). The well plate was sealed with aluminum sealing foil and kept at 15 °C during the measurement process ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 μM Al.488-labeled TDP-43-MBP-His6 was set up in low binding tubes (Eppendorf) in aggregation buffer and incubated with or without 100 μg/ml His6-TEV protease ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μM purified TDP-43-MBP-His6 variants (WT, 5D, 12D, 12A) were set up in low binding tubes (Eppendorf) in 35 μl aggregation buffer (50 mM Tris pH 8.0 ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 mg ml−1 lactic acid in water) and added to 5 mg of pre-washed TiO2 beads and incubated for 30 min on a Thermomixer (Eppendorf) at 1200 rpm to keep the beads in suspension ...
-
bioRxiv - Biochemistry 2021Quote: ... The reactions were stopped by the addition of phosphoric acid and 4 µl of each reaction were spotted on P81 phosphocellulose papers (Whatman) using the epMotion 5070 (Eppendorf) workstation ...
-
bioRxiv - Biochemistry 2021Quote: ... and transferred into pre-chilled Protein LoBind® 2 mL microtubes (Eppendorf AG, Hamburg, Germany). The cells were pelleted by low-speed centrifugation at 800×g for 3 min at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... The absorbance for each fraction at 280 nm was measured with a NanoDrop instrument (Eppendorf, Germany), and peptide concentrations were determined using a molar extinction coefficient of 1280 M-1cm-1 for the single Tyr in Aβ42 (Edelhoch ...
-
bioRxiv - Biochemistry 2021Quote: Fresh FUSm condensates formed under low salt (75 mM NaCl) conditions were left shaking at 650 rpm in a Thermomixer (Eppendorf) at 28°C and monitored by fluorescence microscopy at regular intervals until conversion into fibers ...
-
bioRxiv - Biochemistry 2021Quote: ... at a molar ratio crosslinker to lysines of ∼2.7 for 30 min (except for the time-course experiments, see below) at 37°C shaking at 650 rpm in a Thermomixer (Eppendorf). Protein samples were quenched by addition of ammonium bicarbonate to a final concentration of 50 mM and either directly evaporated to dryness or after an additional centrifugation step for 60 min at 21 000 x g in order to separate the condensed from the dilute phase ...
-
bioRxiv - Bioengineering 2021Quote: ... The second spin protocol applied in plasma quality measurements was 12,000×g RCF for 10 minutes with a commercial high-speed microcentrifuge (5417 R, Eppendorf), also based on cfDNA studies [15].
-
bioRxiv - Bioengineering 2021Quote: ... Experiments were laid out using an epMotion 5073 liquid handler (Eppendorf). For first stage ...
-
bioRxiv - Bioengineering 2021Quote: ... a 96-well plate pre-filled with 20 μL pure water and sorted with designated cells per well was frozen on dry ice for 5 min and heated by ThermoMixer C (Eppendorf) at 95 °C for 10 min followed by spinning down at 3000 rpm for 1 min ...
-
bioRxiv - Bioengineering 2021Quote: ... and 100μL of pre-warmed Mammocult was added to the center of each well using an epMotion 96 liquid handler (Eppendorf). To generate larger rings (maxi-rings ...
-
bioRxiv - Cell Biology 2021Quote: ... The dsRNAs were injected into the worms using a microinjector (Eppendorf, FemtoJet). After the completion of injection ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein solutions were injected into the worms using the FemtoJet microinjector (Eppendorf). After the completion of injection ...
-
bioRxiv - Cell Biology 2021Quote: ... Beads were spun down at 3000 × g for 5 min with minimal deceleration (Eppendorf 5804R) and washed 3 times with RP buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... The supernatant was then concentrated on an Amicon Ultra-50 100K filter column at 3000 × g (Eppendorf 5804R) to reach a final volume of 250 µL ...
-
bioRxiv - Cell Biology 2021Quote: ... monolayers were mechanically stressed by defined pipetting using an electrical pipette (Eppendorf, Hamburg, Germany). The total number of resulting fragments per well was determined using a binocular stereo microscope (SZX2 ...
-
bioRxiv - Cell Biology 2021Quote: Transgenic animals expressing bait and prey constructs were generated by microinjection in the gonads of young adult N2 animals using an inverted microinjection setup (Eppendorf) with 20 ng/ μl of bait and prey plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... and overlayed with Matrigel including medium in 8 well chamber coverglass (0030742036; Eppendorf) as previously described (Debnath et al. ...
-
A GID E3 ligase assembly ubiquitinates an Rsp5 E3 adaptor and regulates plasma membrane transportersbioRxiv - Cell Biology 2021Quote: ... dried using a SpeedVac centrifuge (Concentrator Plus; Eppendorf) and resuspended in buffer A* (0.2% TFA/2% ACN ...
-
bioRxiv - Cell Biology 2021Quote: ... OD600nm was measured using BioSpectrometer basic (Eppendorf, Hamburg, Germany).
-
bioRxiv - Cell Biology 2021Quote: ... Organic upper-layer were transferred into fresh microfuge tube and dried using vacuum concentrator (Eppendorf).
-
bioRxiv - Cell Biology 2021Quote: ... lipid extracts were dissolved in 10 mM ammonium acetate in methanol and transferred to 96-well plates (Eppendorf twintec plate 96). Mass spectrometric measurements were performed in positive ion mode on an AB SCIEX QTRAP 6500+ mass spectrometer ...
-
bioRxiv - Cell Biology 2021Quote: ... for micro-injection (Eppendorf). 3∼4 injected hermaphrodites were pooled per plate and incubated at 20°C for 4 days ...
-
bioRxiv - Cell Biology 2021Quote: ... of AAV1-Cpne4 or AAV1-eGFP control virus were done in P0 or P14 Brn3bCre/WT mice eyes using glass capillaries fitted onto a Femtojet device (Eppendorf, Enfield, CT), as previously described ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2021Quote: ... was harvested by centrifugation at 300 × g for 5 min in a swing out 5804 S-4-72 rotor (Eppendorf). Baculovirus infected insect cell (BIIC ...