Labshake search
Citations for LifeSensors :
1 - 19 of 19 citations for TMEM173 Human HEK293 Sumo His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... coli strain BL21 (DE3) with an N-terminal (His)6-SUMO tag from a pE-SUMO-pro expression vector (LifeSensors). Cells were grown in 2YT media at 24°C to an OD600 of 0.8 and then induced with 0.1 mM isopropyl β-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis KAI2 protein was expressed as a 6× His-SUMO fusion protein using the expression vector pSUMO (LifeSensors). His-SUMO-KAI2 was isolated from by Ni-NTA resin and the eluted His-SUMO KAI2 was further separated by anion-exchange ...
-
bioRxiv - Cancer Biology 2020Quote: ... SUMO (Lifesensors, catalog# AB7002); and IER5 (catalog# HPA029894) ...
-
bioRxiv - Neuroscience 2023Quote: Human TDP-43 and TDP-43-GFP were subcloned into pE-SUMO (LifeSensors, Malvern, PA) as described (McGurk et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... and cloned into pE-SUMO (LifeSensors), resulting in plasmid 3410 (Supplementary Table 8) ...
-
bioRxiv - Molecular Biology 2023Quote: SUMO-conjugated peptides in subcellular fractionation samples were purified with biotin SUMO-Capture Reagent (Biotin S-Cap, LifeSensors Inc., cat # SM-101) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... eluted with 500mM imidazole cleaved using SUMO protease (SUMOpro, Lifesensors), and passed back over Ni- NTA beads ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM β-Mercaptoethanol and 5% Glycerol] containing SUMO protease (LifeSensors) in order to cleave the SUMO tag and generate Pol κ in the native form ...
-
bioRxiv - Molecular Biology 2022Quote: ... ishimotonii CRISPR locus and cloned into the modified pE-SUMO vector (LifeSensors), in which the SUMO-coding region is replaced with the HRV3C protease recognition site ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 mM β-Mercaptoethanol and 5% Glycerol) in the presence of SUMO protease (LifeSensors) to remove the SUMO tag to generate native PolH ...
-
bioRxiv - Biochemistry 2019Quote: ... aeruginosa PAO1 EF-Tu (tufB) coding sequence from plasmid pJP04 (9) into the pE-SUMO vector (LifeSensors). This construct produces His6-SUMO-EF-Tu protein (“SUMO-L0-EF-Tu” ...
-
bioRxiv - Cell Biology 2021Quote: ... and the PH domains from phospholipase C-δ1 (PLCδ-PH) and general receptor for phosphoinositides (GRP1-PH) were constructed by cloning PCR-amplified cDNA into pET-SUMO vector (LifeSensors), in frame with the N-terminal 6His-SUMO tag ...
-
bioRxiv - Biophysics 2022Quote: The sequence-optimised UvrD gene tagged with 8xHis-tag at the N-terminus was cloned into pE-SUMO expression vector (Lifesensors Inc.) using Gibson reaction ...
-
bioRxiv - Biophysics 2020Quote: ... SARS CoV-2 Mpro gene was subcloned from pET29a(+) to pE-SUMO vector according to manufacturer’s protocol (LifeSensors Inc, Malvern PA). pE-SUMO plasmid with SARS CoV-2 Main protease gene (Mpro ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Then the SARS-CoV PLpro gene (ORF 1ab 1541-1855) was subcloned from the pET28b-(+) to pE-SUMO vector according to the manufacturer’s protocol (LifeSensors Inc., Malvern, PA). The forward primer with the Bsa I site is GCGGTCTCAAGGTGAGGTGAAGACCATCAAAGTGTTCACCACC ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the SARS-CoV-2 PLpro gene (ORF 1ab 1564−1876) was subcloned from pET28b(+) to pE-SUMO vector according to the manufacturer’s protocol (LifeSensors Inc., Malvern, PA). The forward primer with the Bsa I site is GCGGTCTCAAGGTGAAGTTCGCACCATCAAAGTTTTTACC ...
-
bioRxiv - Biophysics 2019Quote: ... The plasmid containing the gene for human γS WT was engineered into the pE-SUMO (Small Ubiquitin-like Modifier) vector containing a N-terminal 6XHis tagged fusion protein (LifeSensors Inc., Malvern, PA). The γS N14D and γS N76D were generated via site-directed mutagenesis using QuikChangeXL Kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... except that human recombinant Usp2Core (LifeSensors Inc., Malvern, PA) was used ...
-
bioRxiv - Biochemistry 2020Quote: ... coli codon-optimized sequence of human full length Pol κ (accession no. NP057302) was cloned into a pE-SUMOpro expression vector (Lifesensors) using Gibson assembly technology ...