Labshake search
Citations for Omega Bio-Tek :
1 - 50 of 562 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... mouse skin and kidneys using E.Z.N.A total RNA kit I (Omega Bio-Tek) for cells and TRIzol (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA Kit I (Omega Bio-Tek) according to the manufacture’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Total RNA Kit I (Omega Bio-tek). The column was washed according the manufacturer’s instructions and the purified nucleic acids were eluted in 40 μl nuclease-free water ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmid Mini Kit I (Omega Bio-Tek) and verified by sequencing (Eurofins and Macrogen).
-
bioRxiv - Biochemistry 2021Quote: ... Plasmid Mini Kit I (Omega Bio-tek) from positive colonies (elution with ddH2O ...
-
bioRxiv - Bioengineering 2022Quote: ... Total RNA Kit I (Omega Bio-tek). cDNA was synthesized using SuperScript III reverse transcriptase (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA Kit I (Omega Bio-tek) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... total RNA kit I (Omega Bio-tek). The reverse transcription of RNA into cDNA was performed using a Prime Script TM RT Master Mix (Takara) ...
-
bioRxiv - Immunology 2020Quote: ... total RNA kit I (Omega Bio-tek). Detection of the number of copies of extracted RNA was performed using the Real-Time One-Step RT-PCR reagent (Takara) ...
-
bioRxiv - Physiology 2021Quote: ... Total RNA kit I (Omega Bio-Tek). gRNA and 3’UTR/ sfRNA1 were quantified in absolute numbers using one-step RT-qPCR (Supplementary Table 1 ...
-
bioRxiv - Microbiology 2020Quote: ... Total RNA Kit I (Omega Bio-tek) according to manufacturer’s instructions and samples analysed by real-time quantitative reverse transcription-PCR (RT-qPCR ...
-
bioRxiv - Microbiology 2020Quote: ... total RNA I kit (Omega Bio-Tek). An iScript gDNA clear cDNA synthesis kit (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA Kit I (Omega Bio-tek) according to manufacturer specifications ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA Kit I (Omega Bio-tek). Equal amounts of RNA from each sample were treated with DNase (RQ1 ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA Kit I (Omega Bio-tek). Total RNA was extracted according to the manufacturer’s protocol and eluted into RNase/DNase free H2O and used for library construction ...
-
bioRxiv - Zoology 2022Quote: ... Total RNA kit I (OMEGA Bio-Tek)] with silica beads (BioSpec ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA Kit I (Omega Bio-tek). Total RNA was extracted according to the manufacturer’s protocol and eluted into RNase/DNase free H2O and used for library construction ...
-
bioRxiv - Cancer Biology 2019Quote: ... Total RNA Kit I (R6834, Omega Bio-Tek) and the RNase-free DNase Set I (E1091-02 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA Kit I (Omega Bio-tek, GA). We prepared cDNA libraries with the NEBNext Ultra RNA Library Prep Kit for Illumina (NewEngland Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmid Mini Kit I (Omega Bio-tek, Norcross, GA) according to the manufacturer’s protocol and confirmed by Sanger sequencing by Eton Bioscience (Charlestown ...
-
bioRxiv - Immunology 2022Quote: ... total RNA kit I (Omega Bio-tek, GA, USA) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Total RNA kit I (OMEGA Bio-Tek, Norcross, GA), following manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... Total RNA Kit I (Omega BIO-TEK, R6834-02). Total RNA was reverse transcribed to cDNA with oligo(dT)12-18 and Superscript IV Reverse transcriptase (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... Total RNA Kit I (R6834-02, Omega BIO-TEK). Total RNA was reverse transcribed to cDNA with Oligo(dT)12-18 and Superscript IV Reverse transcriptase (18091050 ...
-
bioRxiv - Biochemistry 2023Quote: ... total RNA Kit I (Omega Bio-Tek, R6834-02). For gene expression analysis ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid DNA Mini Kit I (Omega Bio-tek, D6942-01). pIX-Halo-bZIPs (Halo-bZIP1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the Plasmid Mini Kit I (Omega Bio-Tek, America), following the manufacturer’s instructions and the concentration was determined ...
-
bioRxiv - Cancer Biology 2023Quote: ... using E.Z.N.A.® Plasmid Mini Kit I (Omega Bio-tek, Inc.). To produce lentiviral media ...
-
bioRxiv - Bioengineering 2023Quote: ... E.Z.N.A.® Plasmid DNA Mini Kit I (Omega Bio-Tek, China), isopropyl-β-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Total RNA Kit I (Omega BIO-TEK; VWR catalog no. 101319) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Total RNA was extracted using E.Z.N.A Total RNA kit I (OMEGA Bio-Tek). RNA-seq libraries were prepared using True-Seq Stranded Total RNA with Ribo-Zero Gold kit (Illumina) ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was extracted using E.Z.N.A Total RNA Kit I (Omega BIO-TEK) and retrotranscribed with iScript Supermix (Bio-Rad Laboratories ...
-
bioRxiv - Synthetic Biology 2020Quote: RNA extraction was performed with E.Z.N.A.® Total RNA Kit I (Omega Bio-tek). The protocol was followed according to manufacturer’s instructions and RNA was eluted in 30 μL of RNAse free water ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted with the EZNA Total RNA Kit I (Omega Bio-Tek) and retrotranscribed using the iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad).
-
bioRxiv - Plant Biology 2020Quote: ... Total RNAs were extracted using E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek) and then quality controlled using a NanoDrop™ One UV-Vis spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... and intracellular viral RNA using the E.Z.N.A Total RNA Kit I (Omega Bio-tek), according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2019Quote: RNA from cells was extracted using EZNA Total RNA Kit I (Omega Bio-Tek) and cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... E.Z.N.A.® Plasmid Midi Kit I (D6926-03) was purchased from Omega Bio-Tek, Guangzhou ...
-
bioRxiv - Immunology 2023Quote: Total RNA was extracted by E.Z.N.A.® Total RNA Kit I (Omega Bio-tek) according to manufacturer’s instruction ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was extracted from cells using an E.Z.N.A Total RNA Kit I (Omega Bio-tek) and subsequent cDNA and PCR was run using the miRCURY LNA miRNA PCR Kit (Qiagen ...
-
bioRxiv - Genetics 2020Quote: RNA was extracted using the E.Z.N.A.® Total RNA Kit I (Omega Bio-tek, USA). RNA was DNase I treated (ThermoFisher ...
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... RNAs collected from cells were extracted using E.Z.N.A Total RNA kit I (Omega Bio-Tek #R6834) according to manufacturer’s protocol ...
-
Efficient Natural Plasmid Transformation of Vibrio natriegens Enables Zero-capital Molecular BiologybioRxiv - Synthetic Biology 2023Quote: ... natriegens was accomplished using the E.Z.N.A Plasmid DNA Mini Kit I produced by Omega Bio-Tek, following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were routinely purified using the E.Z.N.A.® Plasmid DNA Mini Kit I (Omega Bio-Tek). Plasmid constructions were carried out in E ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA extraction from cells was performed by E.Z.N.A.β Total RNA Kit I (Omega BIO-TEK) according to the manufacturer’s instructions or extracted with TRIzolβ reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... and their plasmids isolated using a plasmid DNA Mini Kit I (OMEGA Bio-tek, Norcross, GA, USA). The pooled ASKA plasmids (1 µL containing 30 ng of DNA ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from cells using the E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek) following the provided protocol for RNA extraction from cultured cells ...
-
bioRxiv - Pathology 2023Quote: ... viral RNA was extracted from the cells (E.Z.N.A. Total RNA Kit I R6834-01, Omega BIO-TEK) and quantified by RT-qPCR analysis.
-
bioRxiv - Microbiology 2023Quote: ... aureus RN4220 using the E.Z.N.A.® Plasmid DNA Mini Kit I (Omega Bio-Tek, Inc, GA, USA), and purified plasmids pSepiCcrAB ...