Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for rno mir 542 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Primers used were: rno-miR-155-5p (RT:002571, ThermoFisher Scientific), and rno-miR-674-3p (RT:001956 ...
-
bioRxiv - Neuroscience 2024Quote: ... and rno-miR-674-3p (RT:001956, ThermoFisher Scientific). Data were analyzed using StepOne Software v ...
-
bioRxiv - Neuroscience 2024Quote: ... we used rno-miR-191a-3p (RT:002576, ThermoFisher Scientific), which was selected as the most stable in our experiment ...
-
bioRxiv - Physiology 2020Quote: ... The multiplex RT primer pool consisted of primers for miR-150-5p and U6 (Thermo Fisher Scientific). No-template samples where included as negative controls.
-
bioRxiv - Genetics 2020Quote: ... hsa-mir-423-5p (Thermofisher) served as endogenous control for analysis of miRNA expression ...
-
bioRxiv - Molecular Biology 2020Quote: ... and miR-183-5p (Applied Biosystems). Reverse transcription products were then amplified by quantitative PCR (95 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... transfected with the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p or Neg Control 1, Thermo Fisher) for 5-6 days ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal neurons were co-transfected with 300ng of Cav1.2-HA at DIV6 and 10nM of the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p and Neg Control 1, Thermo Fisher), and processed for immunostaining 13 days after ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal neurons were transfected at DIV 5 with 100ng of GFP alone or co-transfected with 10nM of the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p and Neg Control 1, Thermo Fisher). After 5 days of expression ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal neurons were co-transfected at DIV 5 with 10nM of the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p or Neg Control 1, Thermo Fisher) and 100ng of the Cacnb2 3’UTR luciferase reporters ...
-
bioRxiv - Neuroscience 2021Quote: ... hippocampal neurons were transfected at DIV7 with 10nM of the miR-499-5p or control mimic (Ambion™ Pre-miR miRNA Precursor: miR-499-5p and Neg Control 1, Thermo Fisher) with the Lipofectamine RNAiMAX reagent (Thermo Fisher ...
-
bioRxiv - Pathology 2020Quote: ... miR-155-5p or its control scrambled miR (Thermo Scientific Dharmacon) using Effectene (Qiagen ...
-
bioRxiv - Genomics 2023Quote: The mimic-miR-155-5p (Thermo Fisher, mirVanaTM miRNA Mimic ...
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-hsa-miR-Mir9-5p (Ambion, #17000), and Anti-miR negative control (Ambion ...
-
bioRxiv - Neuroscience 2022Quote: ... Reverse-transcriptase-specific primers for mmu-miR-335-5p (Applied Biosystems miRNA assay ID 000546) were used and real-time quantitative PCR performed using TaqMan miRNA assays (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... Q-RT-PCR was performed using TaqMan primers/probe sets (Applied Biosystems) and analyzed as transcript copies per 50 ng RNA expressed relative to RNAPII expression as previously described (33).
-
bioRxiv - Cell Biology 2021Quote: ... and miR-34a-5p (ThermoFisher, Assay ID 000426). 1ul of cDNA was used for real-time PCR using TaqMan™ Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... TaqMan Fast Universal PCR Mastermix and TaqMan miRNA Assays primers were used to detect miR-23a-3p and miR-10b-5p (QuantStudio 12K Flex, Thermo Fisher Scientific). All reactions were run in triplicate and results were expressed as 2−ΔΔCt ...
-
bioRxiv - Immunology 2021Quote: ... Taqman miRNA assays for the housekeeping control gene U6 snRNA (#001973) and hsa-miR-21-5p (which also recognizes mmu-miR-21a-5p) (#000397) were purchased from Thermo Fisher. qPCR was performed using Taqman Universal Master Mix II ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative RT-PCR was performed using Taqman probes and primer sets (Applied Biosystems) specific for CD36 (assay ID Mm00432398_m1) ...
-
bioRxiv - Cell Biology 2019Quote: ... 25 mM of miR-15a-5p (Ambion, 4464066 - MC10235) and miR-1 positive control (Ambion ...
-
bioRxiv - Molecular Biology 2020Quote: ... Synthetic miR-324-5p and Decade Markers System (Ambion) were loaded as size markers ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pre-miR-129-5p was purchased from Thermo Fisher Scientific (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: Cells at 60% confluence were transfected with 40 nM of mirVana™ miRNA mimic of miR-9-5p (miR-9-5p) (4464066, Ambion, Carlsbad, CA) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: Primary cortical neurons were transfected in triplicates with 100ng of pmiR-Glo-plasmids containing wildtype or mutant 3’UTRs of Mdga1 or Shank2 together with pre-miR-218-5p duplex (0.3125pmol for Mdga1 and 1.25pmol for Shank2, Ambion Pre-miR-218-5p Precursor) or respective quantities of pre-miR negative control duplex (Ambion ...
-
bioRxiv - Molecular Biology 2019Quote: ... miRNA mimics and the miR-100 isoforms miR-100-5p and miR-100-3p (all from Life Technologies) using 15 pmol PepMute reagent (SignaGen Labs ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100 nM Anti-miR miRNA Inhibitor to hsa-miR-218-5p (Ambion, Inc., Austin, TX), or 100 nM FlexiTube siRNA to ARF6 (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100 nM Anti-miR miRNA Inhibitor to hsa-miR-218-5p (Ambion, Inc., Austin, TX), or 100 nM FlexiTube siRNA to ARF6 (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... The probes hsa-miR-499a-5p (Alexa Fluor 546; Thermo Fisher) and CamK2 (Alexa Fluor 488 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and miR-140-5p mimics and corresponding scrambled control (SC) (Ambion) using Lipofectamine 2000 reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... MicroRNA was firstly transcribed by miRCURY LNA RT kit to obtain its cDNA and examined for the expression level by specific primers designed for miR-4776-5p (Applied Biosystems). The quantitative PCR was performed by the miRCURY LNA SYBR Green PCR KiT (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... 20nM hsa-miR-129-5p miRIDIAN mimics (miR-129 mimics) or mimic negative control (mimics ctrl)(ThermoFisher Scientific); 20nM has-miR-129-5p miRIDIAN hairpin inhibitor (miR-129 inhibitor ...
-
bioRxiv - Genomics 2023Quote: ... TaqMan™ MicroRNA Assay hsa-miR-423-5p (ThermoFisher, AssayID 002340, 4427975), and TaqMan™ Fast Advanced Master Mix (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... 18S rRNA endogenous control primer/probe set was utilized for semi-quantitative RT-PCR normalization (ThermoFisher, 4333760T). Thermal cycling conditions were adapted from Verso 1-step RT-qPCR kit (ThermoFisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... or hsa-miR-181-5p) (Bioneer) or with a Pre-miR miRNA Negative Control (Bioneer) using Lipofectamine 3000 (Invitrogen).
-
bioRxiv - Developmental Biology 2022Quote: ... Total expression levels of miR-675-3p and miR-675-5p were determined relative to snoRNA202 by using a separate RT kit (TaqMan MicroRNA Reverse Transcription Kit, Thermo Fisher Scientific), qRT-PCR primers (Assay Id 001232 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 U Ribolock (40U/μl), 1x TaqMan RT primer per each gene of interest (miR-7a, miR-671, Let-7a, snoRNA202, U6 snRNA) (Applied Biosystems) and 1x first-strand synthesis buffer were filled up to 20 μl reaction volume with ddH2O and mixed ...
-
bioRxiv - Physiology 2020Quote: mirVana hsa-miR-150-5p (ID MC10070) mimic or scrambled miRNA control (Ambion) in complex with DACC lipoplex preparation (Silence Therapeutics)(Fehring et al. ...
-
bioRxiv - Biochemistry 2019Quote: MiR-216a-5p inhibitor and its relative NC were compounded by Life Technologies Corporation (Carlsbad ...
-
bioRxiv - Cancer Biology 2020Quote: ... with 50 nM miR-10b-5p mimic / ∼105 cells (Thermo Fisher, miRVana, 4464066) or scrambled control (Merck ...
-
bioRxiv - Neuroscience 2022Quote: ... we used hsa-miR-423-5p (suggested as endogenous control by ThermoFisher, Inc) for PD ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were treated for 48 hours with 40nM miR-146a-5p mimic (Ambion) or mirVana miRNA mimic negative control 1 (Ambion) ...
-
bioRxiv - Physiology 2023Quote: ... MiR-125b-5p (MIMAT0000423) or control mimic (Life Technologies, USA, Supplementary Table 1) were delivered to the cell culture using Lipofectamine RNAiMAX (Life Technologies ...
-
bioRxiv - Pathology 2021Quote: ... PCR primers and probe sets were obtained from Thermofisher, USA ...
-
bioRxiv - Immunology 2020Quote: ... Probes for TaqManTM MicroRNA Assay (hsa-miR-424-3p, hsa-miR-424-5p, U6 snRNA control) were purchased from ThermoFisher. All the steps were performed according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... 20nM has-miR-129-5p miRIDIAN hairpin inhibitor (miR-129 inhibitor) or hairpin inhibitor negative control (inhibitor ctrl) (ThermoFisher Scientific) using LipofectamineTM RNAiMAX (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... 10pg of mirVana miRNA mimic miR-199a-5p (ThermoFisher, Assay ID MC10893 and 002304) was added to 0.1-0.5ug of total RNA as a spike-in control for RT-qPCR normalization ...
-
bioRxiv - Microbiology 2019Quote: ... or miR-K6-5p mimic (miRVana) with Lipofectamine RNAiMax (ThermoFisher Scientific, Cat No: 13778150) as instructed ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant vectors were transfected in HEK293 cells with 10 nM of miRNA mimics (miR-3594-5p, mature sequence: CCCAGGGCAGAGCAGUGUGAA; miR-negative control, ThermoFisher scientific) with Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... miR-504-3p or miR-574-5p were reverse transcribed by using TaqMan™ Advanced miRNA cDNA Synthesis Kit (Thermo Scientific) and then amplified by using specific primers provided in the TaqMan Advanced miRNA Assays (Thermo Scientific ...