Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for pTH Related Protein Splice Isoform 3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... We then amplified and eif-3.G cDNA using primers for the SL1 trans-splice leader (YJ74) and eif-3.G isoform A 3′UTR (YJ11560) and Phusion polymerase (Thermo Fisher Scientific, San Diego, CA). The cDNA clones in PCR8 vector were then used to generate tissue-specific expression constructs using Gateway™ cloning destination vectors (pCZGY1091 for Punc-17β ...
-
bioRxiv - Molecular Biology 2022Quote: ... pDNOR207-ZNF451-1 (isoform 1) and pDNOR207-ZNF451-3 (isoform 3) were generated using the Gateway® cloning BP reaction (Thermo Fisher Scientific) upon cDNA amplification using BP-tailed primers and pDNOR207 as donor vector ...
-
bioRxiv - Genetics 2019Quote: The relative abundance of the two splice isoforms of pitx2 (pitx2a and pitx2c) were measured using PowerUp Sybr Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) and a BioRad CFX 96 or 384 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Genomics 2020Quote: ... Two TaqMan probes targeting the MLLT3 exon 3-4 and exon 9-10 splice junctions (ThermoFisher, Hs00971092_m1 and Hs00971099_m1) were used with cDNA diluted 1:5 in dH2O to perform qPCR for six replicates per sample on an Applied Biosystems Quant Studio 6 Flex ...
-
bioRxiv - Cell Biology 2022Quote: 6xHis-14-3-3 isoforms were expressed in BL21(DE3) bacterial cells and purified in batch by IMAC with ProBond™ resin (Invitrogen). After elution with imidazole ...
-
Macrophage microRNA-146a is a central regulator of the foreign body response to biomaterial implantsbioRxiv - Cell Biology 2024Quote: ... and related reagents were purchased from Gibco. Mouse-recombinant IL-4 ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples were sequenced by Edman Degradation using a Perkin Elmer 494 Procise Protein/Peptide Sequencer with an on-line 140C PTH Amino Acid Analyzer (Applied Biosystems, Inc).
-
bioRxiv - Neuroscience 2019Quote: ... harbouring the full-length cDNA coding for the human muscle 6-phosphofructo-1-kinase muscle isoform (PFK1-M)3 (accession number, NM_000289.1) using Lipofectamine LTX-PLUS Reagent (Life Technologies) according with manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... was performed on an Orbitrap Exploris 480 (related to Figure S2A and B) or an Orbitrap Fusion Lumos mass spectrometer (related to Figure 4E and F) (Thermo Fisher Scientific) connected to a Thermo Ultimate 3000 RSLCnano pump equipped with a self-pulled analytical column (150 mm length × 100 μm i.d. ...
-
bioRxiv - Cell Biology 2021Quote: ... Related Taqman™ probes were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... We identified unique proteins related to biocontrol capacities of Ba168 by using liquid chromatograph-mass spectrometer (LC-MS) (Thermo Fisher) and molecular weight greater than 5000 can be identified ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell culture and other related consumables were procured from Nunc, Thermofisher and Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: Short hairpin RNA (shRNA) sequences specifically targeting circE7 back-splice junction were designed from Invitrogen BLOCK-ItTM RNAi Designer (https://rnaidesigner.thermofisher.com/rnaiexpress/) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We generated expression constructs using a 2876 bp promoter for the C isoform of kcnl-1 and a 3’ UTR from unc-54 by three-fragment Gateway cloning (Thermo Fisher, USA). See Table S2 for details ...
-
bioRxiv - Bioengineering 2019Quote: ... Cell culture medium and PCR related reagents were purchased from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... All other cell culture related materials were obtained from Life Technologies.
-
bioRxiv - Neuroscience 2023Quote: ... and calcitonin gene-related peptide (CGRP) (ThermoFisher, cat # PA185250, 1:500) overnight at 4°C ...
-
bioRxiv - Physiology 2024Quote: Titin isoforms were separated on a 1% w/v agarose gel and stained with SYPRO Ruby protein gel stain (Invitrogen, ThermoFisher Scientific) as previously described.30 All samples were measured in triplicate and the average of triplicate measurements per sample was shown.
-
bioRxiv - Biochemistry 2022Quote: Full length MITF isoform M cDNA was purchased from ThermoFisher Inc ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... a full length D2R mRNA isoform was synthesized by Invitrogen with the sequence coding for V5 (GKPIPNPLLGLDST ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclear factor erythroid 2-related factor 2 (NRF2) (ThermoFisher Scientific, Carlsbad, CA), samples diluted 1:2 ...
-
bioRxiv - Neuroscience 2023Quote: ... and the related SilencerTM select siRNA negative control (Thermo Fisher Scientific, 4390843) were purchased ...
-
bioRxiv - Cell Biology 2024Quote: ... Non-related control siRNA (siNR, Silencing Select Negative Control 1, ThermoFisher Scientific) concentration was matched in each experiment.
-
bioRxiv - Cell Biology 2023Quote: The 5’ end of the mouse Pdgfrβ i10 splice variant was elucidated using the GeneRacerTM Kit (Invitrogen). The P90 WT (c57BL/6 ...
-
bioRxiv - Microbiology 2024Quote: ... NCBI ID: JX869059) with removed potential splice sites were cloned into a pcDNA3.1 expression vector (V79020, ThermoFisher) in frame with a C-terminal V5-tag ...
-
bioRxiv - Physiology 2024Quote: Titin isoforms were separated on a 1% w/v agarose gel and stained with SYPRO Ruby protein gel stain (Invitrogen, ThermoFisher Scientific) as previously described.30 All samples were measured in triplicate and the average of triplicate measurements per sample was shown.
-
bioRxiv - Epidemiology 2019Quote: Genotyping of UK Biobank samples was conducted with two closely related arrays (Affymetrix using a bespoke BiLEVE Axiom array and Affymetrix UK Biobank Axiom array ...
-
bioRxiv - Developmental Biology 2020Quote: ... All isoforms were sequenced on an ABI 3730XL capillary sequencer (Applied Biosystems) and reads were visualized and aligned in MEGA4 (42) ...
-
bioRxiv - Immunology 2023Quote: ... RNA of each trib isoform was transcribed using mMessageMachine kit (Ambion, Invitrogen) and diluted to 100ng/μl in phenol red (PR ...
-
bioRxiv - Immunology 2023Quote: ... RNA of each trib isoform was transcribed using mMessageMachine kit (Ambion, Invitrogen) and diluted to 100ng/μl in phenol red (PR ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ret51 (ENSDART00000077627.7) splice variants were amplified from cDNA libraries using forward (GGCTCCTTTCGCTCGAATCA) and reverse (ACACTCAGCTTAATGTAGTTATTGTTGCAC) primers and Phusion PCR (Invitrogen). ret9 and ret51 splice variant amplicons were cloned into pCR-Blunt II-TOPO vector using manufactures instructions (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... and Jurkat related cell lines are cultured in RPMI supplemented with 10% FBS (Invitrogen) and 1X pen/strep ...
-
bioRxiv - Immunology 2020Quote: ... Confocal related reagents included antigen retrieval buffer low pH (cat. 00-4955-58, Invitrogen), donkey serum (cat ...
-
bioRxiv - Genomics 2022Quote: ... (3) protein A magnetic dynabeads (Thermo Fisher Scientific) were used ...
-
bioRxiv - Immunology 2023Quote: ... 3 μL HiFi Cas9 protein (61 μM; Invitrogen) was mixed with 2 μL Buffer R for each reaction (Neon Transfection System Kit ...
-
bioRxiv - Microbiology 2021Quote: Charged residues within the coiled-coil region were replaced with alanine by splice overlap PCR mutagenesis using Accuprime pfx polymerase (Invitrogen). PCR products containing the alanine mutation were cloned under the control of the ara promoter by insertion into pBAD33 by digestion with Kpn1 (NEB ...
-
bioRxiv - Genomics 2019Quote: ... Proteins were separated on NuPAGE 3-8% Tris-Acetate Protein Gels (Thermo Fisher). The primary antibodies used were mouse anti-CAS9 (7A9-3A3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... ret9 and ret51 splice variant amplicons were cloned into pCR-Blunt II-TOPO vector using manufactures instructions (Invitrogen: REF 45-0245). Zero Blunt TOPO reactions were transformed into Max Efficiency DH5α bacteria (Invitrogen ...
-
bioRxiv - Biophysics 2022Quote: Mfsd2a isoform B from zebrafish (Uniprot Q6DEJ6) was subcloned in the pFasbac1 vector (Invitrogen) with a N-terminal-10Xhis tag ...
-
bioRxiv - Neuroscience 2020Quote: ... 293T cells were transfected with different CCM2 isoform-MYC constructs by Lipofectamine2000 (Life Technologies) when cells reached 75% confluency ...
-
bioRxiv - Genomics 2019Quote: Taqman assays targeting unique junctions of MX2 transcript isoforms were obtained from Thermo Fisher (full-length transcript ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 µg of proteins measured with the Micro BCA Protein Assay Kit (Thermo Scientific) following the instructions of the supplier ...
-
bioRxiv - Plant Biology 2021Quote: ... proteins were resolved in 3-12% and NativePAGETM (Invitrogen) gels ...
-
bioRxiv - Genomics 2024Quote: ... Then pre-pro-PTH and R56Cpre-pro-PTH were each cloned into pcDNA3.1-ccdB-3xFLAG-V5 with LR Gateway™ LR Clonase™ II Enzyme mix (Invitrogen, USA) to construct pcDNA3.1-(pre-pro-PTH)-3xFLAG-V5 ...
-
bioRxiv - Neuroscience 2022Quote: ... as the authors generated a custom TaqMan primer/probe to detect the exon 32/intron 32 splice site (#AJWR28J, Thermo Fisher Scientific). When screening the XDP female carrier iPSC lines ...
-
bioRxiv - Genetics 2024Quote: 10 µM of purified TREX1 mutant protein and 3✕ SYPRO Orange Protein dye (Life Technologies) were loaded into a 96-well reaction plate ...
-
bioRxiv - Developmental Biology 2020Quote: ... A mouse monoclonal antibody for cardiac isoform Ab-1 Troponin (ThermoFisher Scientific #MS-295-P) was added to the coverslip-containing wells at a 1:100 dilution in blocking buffer and incubated on a rocker for 2 hours at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... The Jpx E1-E3 isoform was cloned into pEF1/V5-His vector (Invitrogen Cat# V92020), which contains an EF-1α promoter for mammalian expression and a T7 promoter for in vitro transcription ...
-
bioRxiv - Microbiology 2020Quote: Human DHFR isoform 1 cDNA was codon optimized and purchased as a gene block (Invitrogen) containing 5’ NdeI and 3’ BamHI cut sites ...
-
bioRxiv - Neuroscience 2019Quote: ... together with 3 μL prestained protein ladder (ThermoFisher Scientific, 26619). The gels were run at 70 mV for 3 hours ...