Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for mu p75 SAP Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 0.5 µl of SAP (Affymetrix), 0.1 µl E ...
-
bioRxiv - Genetics 2021Quote: ... Subsequent amplicons were Exo-SAP treated (Exo I, NEB Cat # M0293S and SAP, Affymetrix Cat # 78390) and Sanger sequenced.
-
bioRxiv - Neuroscience 2022Quote: ... Then Shrimp Alkaline Phosphatase (SAP) reaction (total volume 10 µl) was performed with 10× SAP buffer (Affymetrix), 0.5 µl of SAP (Affymetrix) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 20 mU RNaseH (Invitrogen)) was added to each well ...
-
bioRxiv - Microbiology 2020Quote: ... 1.5 mU RNAseA (Thermo Scientific) was added to each lysate ...
-
bioRxiv - Developmental Biology 2022Quote: ... purified by Exo-Sap-IT (Affymetrix, 78201) to remove unincorporated primer ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from heart (P75) using TRIzol (Thermo Fisher) and the SV Total RNA Isolation System (Promega) ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was treated with Exo-SAP-IT (ThermoFisher) and incubated at 37°C for 15 min followed by a 15 min incubation at 80°C to inactivate the enzyme ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mU/mL penicillin (Fisher Scientific), and 1 mg/mL streptomycin sulfate (Fisher Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: Xylem sap protein concentrations were determined with Pierce® Coomassie Plus kit (Thermo Fisher Scientific), which is based on the Bradford method (Bradford ...
-
bioRxiv - Genomics 2020Quote: ... with excess primers removed with EXO-SAP-IT (Affymetrix), and then amplified samples were diluted 1/5 in DNA suspension buffer ...
-
bioRxiv - Bioengineering 2023Quote: ... and 1.0 mU/mL horseradish peroxidase (ThermoFisher) were supplemented into the cell culture media ...
-
bioRxiv - Bioengineering 2022Quote: ... The PCR products were purified using EXO-SAP enzyme (ThermoFisher) and sent for Sanger sequencing analysis (through Genewiz) ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR product was purified using EXO-SAP enzyme (ThermoFisher) and sent for Sanger sequencing analysis ...
-
bioRxiv - Genomics 2019Quote: ... amplicons were cleaned with Exo-SAP (Affymetrix, Santa Clara, CA, USA), quantified with QuantiFluor dsDNA system (Promega ...
-
bioRxiv - Genomics 2023Quote: ... 1 ul of EXO-SAP-IT Express (Life Technologies-75001.1.ML) was added to the reaction ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µl of EXO-SAP (100 U shrimp alkaline phosphatase (Thermo Scientific), 100 U Exonuclease I (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplicons were cleaned using Exo-SAP-IT (Affymetrix, Santa Clara, CA, USA), and Sanger-sequenced at the Core Genomic Facility at the University of Sheffield ...
-
bioRxiv - Molecular Biology 2022Quote: ... The amplified products were treated with Exo-Sap II (Thermo Fisher Scientific), and sequence termination reactions were performed from both directions of strands using BigDye Terminator v3.2 (Applied Biosystem) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The p75/LEDGF isoform was cloned in pENTR/D-TOPO cloning vector (Invitrogen, Cat. No. 45-0218), with PCR-based techniques ...
-
bioRxiv - Genetics 2021Quote: ... The PCR products were purified with 3 μl Exo/SAP and then cycle-sequenced with the BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) according to manufacturer instructions with BP15851 (M13F ...
-
bioRxiv - Genomics 2021Quote: ... The PCR products were treated with Exo-Sap (ExoSAP-IT™, Thermo Fisher, USA) to remove unutilized primers and dNTPs ...
-
bioRxiv - Microbiology 2021Quote: Purified substrates and cleavage product mixtures were dephosphorylated by incubating with SAP (ThermoFisher, USA) at 37°C for 1 h according to the manufacturer’s protocol ...
-
bioRxiv - Zoology 2021Quote: ... we purified the amplified DNA using USB Exo-SAP-IT (Affymetrix, Santa Clara, CA) and bidirectionally sequenced the amplicons using an ABI 3130 DNA Analyzer (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... the resulting DNA from the PCR reaction was purified via EXO-SAP cleanup (Affymetrix). Individual EXO-SAP reactions consisted of 1.55ul dH2O ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0.1 mU/µL inorganic pyrophosphatase (all from Thermo Fisher Sci.; Waltham, MA), 2 mM spermidine (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: Microdissected areas were digested with 10 mU of Proteinase K (ThermoFisher, #AM2546) in 6 ml of digestion buffer (0.05% Triton X-100 ...
-
bioRxiv - Microbiology 2021Quote: ... followed by purification using the Exo-SAP-IT PCR product clean-up reagent (Thermofisher, Australia) according to manufacturer instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... Mu-STOP transposon was then released from pGEM::Mu-STOP by BglII digestion and purified by GeneJET Gel Extraction Kit (Thermo Fisher). 100 ng of the purified Mu-STOP transposon was mixed with 500 ng of the target plasmid ...
-
bioRxiv - Physiology 2023Quote: ... 7.4) containing 25 mU/ml insulin (Cat #RP-10908; Thermo Fisher, Waltham, MA) and 10 mM U-13C6-glucose (Sigma #310808 ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 mM Tris:HCl pH 7.5) supplemented with 1 mU Turbo DNase (Thermo Fisher Scientific), 0.1 mM PMSF and 35 µg/mL lysozyme ...
-
bioRxiv - Plant Biology 2019Quote: ... Mu-STOP insertion sites were determined by colony PCR using DreamTaq DNA polymerase (Thermo Fisher) and PCR amplicon sequencing ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... after enzymatic clean up with Exo-SAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific, Waltham, MA, USA) applying a 10x dilution of the Exo-SAP-IT but otherwise following the manufactureŕs instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... in 1X SAP buffer provided and supplemented with 1 mM DTT and 60 units RNaseOUT (Invitrogen; Carlsbad, CA, USA) for 1 hr at 37°C ...
-
bioRxiv - Genomics 2023Quote: The double-stranded linkers were converted into single-stranded to successively allow the second strand synthesis by Shrimp Alkaline Phosphatase (1 U/μl SAP, catalog num. 78390, Affymetrix) and Uracil-Specific Excision Reagent (1 U/μl USER ...
-
bioRxiv - Neuroscience 2020Quote: ... The resulting cDNA underwent another final second round IVT step at 37 °C overnight and followed EXO-SAP treatment (Affymetrix 78200) for 15 minutes at 37 °C ...
-
bioRxiv - Plant Biology 2019Quote: ... The 3’ A overhang was then introduced to the Mu-STOP amplicon by DreamTaq DNA polymerase (Thermo Fisher), and the resulting Mu-STOP amplicon was cloned into pGEM-T Easy (Promega) ...
-
bioRxiv - Genomics 2020Quote: ... the aRNA was treated with 6 μL EXO-SAP (ExoSAP-IT™ PCR Product Cleanup Reagent, Thermo Fisher Scientific, Cat. # 78200.200.UL) at 37°C for 15 min followed by fragmentation with 5.5 μL fragmentation buffer (200 mM Tris-acetate (pH 8.1) ...
-
bioRxiv - Neuroscience 2020Quote: Short hairpin RNAs against the mu and delta receptors were designed using BLOCK-IT RNAi Designer software (Invitrogen, USA). The sequences of the 21-nt fragments complementary to the target mRNAs were GCTGCCCTTTCAGAGTGTTAA (Oprm1-1) ...
-
bioRxiv - Genetics 2020Quote: ... Fragment analysis was conducted at the MU DNA Core Facility using an Applied Biosystems 3730xl DNA Analyzer (Applied Biosystems). The expected wildtype fragment size was 294 bp ...
-
bioRxiv - Plant Biology 2021Quote: ... GUS activity was determined by measuring the fluorescence (excitation wavelength 365 nm and emission wavelength 460 nm) of produced 4-Methylumbelliferon (4-MU) in a 96well polystyrene microwell plate (Nunc F96 black flat bottom, ThermoFisher) by the Tecan Infinite 200 PRO microplate reader ...
-
bioRxiv - Plant Biology 2021Quote: 5 μg of RNA from 5-day-old seedlings was first treated with 1 unit of Shrimp Alkaline Phosphatase (SAP; USB Products, Affymetrix, Inc.; Cleveland, OH, USA) in 1X SAP buffer provided and supplemented with 1 mM DTT and 60 units RNaseOUT (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... One millilitre of fresh sap or control sample was freeze-dried using a SpeedVac concentrator unit (model Savant SPD121P, Thermo Scientific, Waltham, MA, USA) at 40 □ ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Formation of 4-methylumbelliferone (4-MU) was measured from 100 μL of stopped reaction mixture in cell culture treated optical bottom black polystyrene microplates (Thermo Scientific, cat #165305) in a plate reader (Biotek HT Synergy ...
-
bioRxiv - Biochemistry 2021Quote: Fraction HMO-2 was digested by treatment of 10 µg dried sample with β-galactosidase from bovine testes (10 mU, Prozyme, Invitrogen, Karlsruhe, Germany) in 20 µl of 0.1 M citrate/phosphate buffer ...
-
bioRxiv - Genetics 2020Quote: ... Sanger sequencing was conducted at the MU DNA Core Facility using an Applied Biosystems 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA) with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).
-
bioRxiv - Plant Biology 2021Quote: ... GUS activity was determined by measuring the fluorescence (excitation wavelength 365 nm and emission wavelength 460 nm) of produced 4-Methylumbelliferon (4-MU) in a 96well polystyrene microwell plate (Nunc F96 black flat bottom, ThermoFisher) by the Tecan Infinite 200 PRO microplate reader ...
-
bioRxiv - Bioengineering 2023Quote: DNA assay kit QuantiT dsDNA HS kit (Invitrogen) was used to quantify the DNA content from cell lysate according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... following kit instructions (BCA Protein Assay kit, ThermoFisher #23225) and 20µg loaded into each well of a NuPAGE 4-12% Bis-Tris Gel (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... mitochondria isolation kit and IL-6 kit were from Invitrogen and were purchased from ALT Ukraine Ltd (representative of Thermo Fisher Scientific in Ukraine).