Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Zika Virus DIII Envelope Protein Asian strain since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ZIKV cDNA was generated from RNA isolated from the ZIKV African MR766 strain and Asian PRVABC59 strain by One-Step RT PCR (SuperScript III, Thermo Fisher Scientific) with primers ZKV NS4B IVT F1 (5’-GAATTCTAATACGACTCACTATAGGGGCATCTAATGGGAAGG AGA-3’ ...
-
bioRxiv - Microbiology 2020Quote: Zika virus RNA yields were assessed using real-time PCR on a 7500 Fast Real-Time PCR instrument (Thermo Scientific, Poland). ZIKV cDNA was amplified in a reaction mixture containing 1× TaqMan Universal PCR Master Mix (RT-PCR mix ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with psPAX2 and pMD2.G packaging and envelope virus using lipofecctamine 3000 (Invitrogen) in serum-free Opti-MEM media (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... and H1N1/2009 influenza virus strains were prepared by overnight incubation of the virus strains with 0.1% v/v β propiolactone (Acros Organics, Geel, Belgium) under continuous rotation at 4°C ...
-
bioRxiv - Microbiology 2020Quote: Recombinant biotinylated proteins (sE, sE-cvD and DIII) were expressed at 28°C using ExpiFectamine™ 293 Transfection Kit (Thermo Fisher Scientific). Cell supernatant was harvested and dialyzed ...
-
bioRxiv - Immunology 2022Quote: ... after which cells were permeabilised (0.1% Triton X100) and stained with an antibody recognising dengue virus envelope protein (Invitrogen MA1-27093, for DENV serotypes 1-3), pan flavivirus envelope (Millipore MAB10216 ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells were co-transfected with the pNL4.3.Luc.R-E-viral vector as well as a plasmid expressing the vesicular stomatitis virus glycoprotein (VSV-G) envelope (pMD2.G) using Lipofectamine 3000 (Life Technologies) according to basic manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... coli (K-12 strain), and Staphylococcus aureus (Wood strain, without protein A) (Molecular Probes), were washed 3 times with PBS by centrifugation and sonicated for 3 times at 50 KHz for 20 s ...
-
bioRxiv - Immunology 2020Quote: ... pEco envelope was used to produce virus to infect murine T cells) using lipofectamine 2000 (Cat. No. 11668019, Invitrogen, Carlsbad, California, USA) on a 100□mm2 poly-D-lysine–coated plate (Corning ...
-
bioRxiv - Immunology 2020Quote: ... aureus bioparticles (Wood strain without protein A) (Thermofisher) were resuspended in PBS with 2 mM sodium azide and 4–20×106 bioparticles were injected directly into tumors ...
-
bioRxiv - Evolutionary Biology 2023Quote: The European and East Asian samples were cultured on Mitis Salivarius Agar (5% Sucrose (Fisher Scientific), 1.5% Peptone (Oxoid) ...
-
bioRxiv - Microbiology 2023Quote: ... Presence of each virus strain in the supernatant was determined by PCR using Taq polymerase (Thermo Scientific) and 20 μL reactions containing 1 μL of virus supernatant ...
-
bioRxiv - Synthetic Biology 2020Quote: Proteins were expressed from E.coli BL21-AI strains (Invitrogen) carrying appropriate plasmids for expression of E.coli Gnd or E.coli RpiA (ribose-5-phosphate isomerase ...
-
bioRxiv - Microbiology 2020Quote: ... A proprietary but publicly available probe set specific for positive sense ZIKV (Asian lineage) RNA was used (Thermofisher). Positive staining (red ...
-
bioRxiv - Molecular Biology 2023Quote: ... BL21(DE3) protein expression strain was obtained from Thermo Fisher Scientific.
-
bioRxiv - Immunology 2021Quote: ... The lentiviral envelope vector pLP/VSVG (Invitrogen) and the packaging vector psPAX2 (Trono lab ...
-
bioRxiv - Molecular Biology 2020Quote: ... and envelope plasmid in OptiMEM (Life Technologies) for 5 to 6 hours (PEI:total pDNA μg ratio 2:1) ...
-
bioRxiv - Microbiology 2022Quote: ... and the concentration of total virus proteins were determined by a BCA protein assay kit (Thermo Fisher) (31 ...
-
bioRxiv - Microbiology 2023Quote: Influenza A virus (IAV) strain A/WSN/33 [H1N1 subtype] was propagated in Madin-Darby Canine Kidney (MDCK) cells (ThermoFisher). Cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Immunology 2022Quote: ... or mouse anti-Hepatitis C virus Core protein (clone C7-50, Life Technologies) were visualised using IRDye 800CW Donkey anti-Rabbit IgG or Goat anti-Mouse IgG (LiCor) ...
-
bioRxiv - Microbiology 2020Quote: SADS-CoV spike glycoprotein (virus strain GDS04; GenBank No.: ASK51717.1) gene was synthesized with codons optimized and inserted into pFastBac vector (Life Technologies Inc.). The ectodomain of SADS-CoV spike protein without the transmembrane anchor and intracellular tail (residues 18-1068 ...
-
bioRxiv - Biochemistry 2019Quote: Antibodies and antibody Fabs were produced as described previously.57 BG505 N332 SOSIP gp140 envelopes were expressed as previously described with minor modifications.58 Envelope production was performed with Freestyle293 cells (Invitrogen). On the day of transfection ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration of the purified virus preparations was determined using a BCA protein assay kit (Thermo Fisher Scientific) prior to the addition of lysis buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... the VSV-G envelope protein vector pMD2.G and the respective pGIPZ-shRNA-target plasmid using lipofectamine 3000 (Invitrogen #L3000008). Filtered virus supernatant was used to transduce MDA-MB-468 and 4T1 cells in DMEM supplemented with 2% FBS ...
-
bioRxiv - Biophysics 2023Quote: For protein expression and purification experiments we employed the commonly used protein expression strains BL21(DE3) (ThermoFisher Scientific) 20 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We used strain YDL185W from the green fluorescent protein (GFP) clone collection (Invitrogen), which expresses Vma1p-GFP fusion protein [30] ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins were expressed in Escherichia coli strain BL21(DE3)pLysS (Thermo Fisher Scientific). 1-4 liters of cells were grown in Luria-Bertani (LB ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins from virus-infected cells were immunoprecipitated using protein G magnetic Dynabeads according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Briefly ...
-
bioRxiv - Biochemistry 2020Quote: ... coli strain (ATCC 11303 strain, 14380, Affymetrix) were used.
-
bioRxiv - Immunology 2019Quote: ... Unlabeled Staphylococcus aureus (Wood strain without protein A) BioParticles were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2022Quote: For protein purification Escherichia coli strains were tested for optimal expression: BL21 DE3 (Thermofisher) was selected for PpMurE_L63_pPROEX and BL21(DE3) ...
-
bioRxiv - Microbiology 2019Quote: ... Strains used for cloning and expression of recombinant proteins were Escherichia coli TOP10 (Invitrogen) and E ...
-
bioRxiv - Systems Biology 2020Quote: ... and 0.6μg pMD2.G (encoding VSV G envelope protein) was diluted in 2000μl Opti-MEM® Reduced Serum medium (Gibco™/ Life Technologies). 5.4μl PLUS™ Reagent was added directly to the diluted DNA and incubated for 5min at RT ...
-
bioRxiv - Systems Biology 2020Quote: ... and 0.6μg pMD2.G (encoding VSV G envelope protein) was diluted in 2000μl Opti-MEM® Reduced Serum medium (Gibco™/ Life Technologies). 5.4μl PLUS™ Reagent was added directly to the diluted DNA and incubated for 5min at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 260 ng pMD.G envelope plasmid using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.25 µg envelope plasmid diluted in 100 µl optiMEM (Gibco) was mixed with 20 µl of PolyFect transfection reagent (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... Media containing virus particles was first concentrated to 20x using 100K MWCO protein concentrator columns (Thermofisher). Concentrated virus was then incubated using 1:2000 DiD-Cell labelling solution (ThermoFisher V22887 ...
-
bioRxiv - Microbiology 2023Quote: ... coli strains DH5α and DH10B strains (both from Invitrogen) were used for molecular cloning ...
-
bioRxiv - Microbiology 2021Quote: ... Porcine reproductive and respiratory syndrome virus [PRRSV] European and North American strains (LSI VetMAX™ PRRSV EU/NA Real-Time PCR Kit; Thermo Fisher Scientific, MA, USA), Swine influenza virus [SIV] (EXOone Influenza A ...
-
bioRxiv - Microbiology 2021Quote: Vero81 cells were adsorbed with CHIKV strains diluted in virus dilution buffer (VDB, RPMI medium with 25 mM HEPES [Gibco] supplemented to contain 1% FBS) at a multiplicity of infection of 0.01 plaque-forming units (PFU)/cell at 37°C for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Strains with GFP-labeled endogenous proteins were from the yeast GFP clone collection (ThermoFisher Scientific) (52) ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli strain (Thermofisher), and purified using a Plasmid DNA Gigaprep kit (Zymo) ...
-
bioRxiv - Microbiology 2024Quote: ... coli strain (Invitrogen) was used for cloning and routinely grown at 37°C (30°C for protein production ...
-
bioRxiv - Biochemistry 2024Quote: ... coli strain (ThermoFisher), blue-white colony screen was performed ...
-
bioRxiv - Developmental Biology 2022Quote: Mouse zygotes (C57BL6/N strain) were injected with 200 ng/µL Cas9 protein (IDT and ThermoFisher), 100 ng/µL Fzd2-specific sgRNA (GCAAGACACTGCACTCGTGG) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse zygotes (C57BL/6N strain) were injected with 200 ng/μl CAS9 protein (IDT and ThermoFisher), 100 ng/μl Tgfbr2-specific sgRNA (AGGTCAAGTCGTTCTTCACT) ...
-
bioRxiv - Cell Biology 2023Quote: ... BacMam 2.0 virus (Invitrogen, C10593).
-
bioRxiv - Microbiology 2019Quote: ... The purified virus was quantified using the bicinchoninic acid (BCA) protein assay kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... Loss of virus was monitored by staining with anti-Sendai virus antibody (Invitrogen, cat #14649482).
-
bioRxiv - Biophysics 2022Quote: ... and pCMV-VSV-G envelope plasmids using Lipofectamine 2000 (Thermo Fisher Scientific) as recommended by the manufacturer ...