Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Tetratricopeptide Repeat Protein 5 TTC5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 5 µg antibody was coupled to 50 µl Protein A or Protein G Dynabeads (Invitrogen). The following antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... 5 μg of antibody bound to 50 μl protein A or protein G Dynabeads (Invitrogen) was incubated with soluble chromatin overnight at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were further lysed via sonication (10 sec on 5 sec off, repeat 3x, ThermoFisher: FB120, 4°C) and protein was clarified by centrifugation at 21,000 x g for 5 min at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... using 3–5 µg of primary antibody against each protein and protein-G magnetic Dynabeads (10003D, Invitrogen) and incubated overnight at 4°C on rotation ...
-
bioRxiv - Cell Biology 2021Quote: ... for first repeat and Q Exactive Plus (Thermo Scientific) mass spectrometer for second repeat samples ...
-
bioRxiv - Neuroscience 2022Quote: ... The antibody-protein complexes were then captured by addition of Protein G magnetic Dynabeads (5 μL beads/μg antibody; Thermo Scientific, cat. no. 13424229) followed by further incubation for 1 h at 4°C with end-over-end rotation ...
-
bioRxiv - Genomics 2024Quote: ... 5-10 μg of antibody was coupled to 50-100 μl of Protein A or Protein G Dynabeads (Invitrogen). The following antibodies were used ...
-
bioRxiv - Genomics 2019Quote: ... Soluble material was incubated with 3-5 μg of antibody bound to 50 μl protein A or protein G Dynabeads (Invitrogen) and incubated overnight at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and interacting proteins were co-immunoprecipitated with 5 µg of anti-gag antibody per mg of total proteins using Dynabeads protein G (Invitrogen). Proteins were solubilized in Laemmli buffer and separated by SDS–PAGE ...
-
bioRxiv - Neuroscience 2021Quote: ... with 5 μg primary antibody and 50 uL Pierce Protein G magnetic beads (Thermo Scientific). The primary antibodies used were rabbit anti-EMX2 (HPA065294 ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were incubated with 5 µg anti-FLAG antibody bound to Protein G Dynabeads (Invitrogen).
-
bioRxiv - Genetics 2019Quote: ... Nine out the 10 repeat tracts were ordered from ThermoFisher (GeneArt) as 151 bp DNA fragments containing 100 bp of repeated sequence flanked by Sap I sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µl Protein G Dynabeads (Invitrogen). Aforementioned volumes of magnetic beads were washed twice with 200 µl ChIP buffer 1 with BSA ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 or 5 ug of appropriate antibodies or IgG control proteins were bound to protein G Dynabeads™ as per manufacturer instructions (Life Technologies). Equal portions of cleared lysates were added to antibody or IgG bound Dynabeads™ and incubated for 3 hours or overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Centromeric repeat probes were amplified by PCR using Biotin-11-dUTP (Thermofisher) with primer TCTAGCACTTGTAATCAATCAAATTC and AGAAGTGAGAAGAAAGACTTG ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was extracted from each repeat using Trizol (Life Technologies, Invitrogen) and DNA was removed by RQ1 DNase (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was extracted from each repeat using Trizol (Life Technologies, Invitrogen) and DNA was removed by RQ1 DNase (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from each repeat using Trizol (Life Technologies, Invitrogen) and DNA was removed by RQ1 DNase (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from each repeat using Trizol (Life Technologies, Invitrogen) and DNA was removed by RQ1 DNase (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... 42Q and 63Q repeats (GenBank Accession #: MK291497-MK291499) were synthesized (Life Technologies) by adding XbaI and SacI restriction enzyme cutting sites at the 5’ and 3’ ends of each DNA sequence for sub-cloning ...
-
bioRxiv - Developmental Biology 2022Quote: ... The protein-antibody-sepharose mixture was then washed 5 times in Pierce IP lysis buffer (ThermoFisher Scientific) and resuspended in 2X Laemmli sample buffer (Sigma) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The supernatant was incubated with anti-GFP antibody (5 μg/ml) prebound to Dynabeads Protein A (Invitrogen) for 2h with end-over-end rotation to capture GFP-fused L10a subunit of the 60S ribosome ...
-
bioRxiv - Genetics 2021Quote: ... analysis using a WD repeat-containing protein on Y chromosome (WDY)- and Rp49-specific primer mix by ampliTaq Gold 360 master mix (Applied Biosystems, Foster City, CA, USA), and then the amplified DNA fragments were separated by 2% agarose gel electrophoresis (S1 Fig).
-
bioRxiv - Plant Biology 2020Quote: ... 5 μl of protein ladder (ThermoFisher #26617) was used for migration control ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein A (5 mg; Thermo Fisher Pierce) was resuspended in 1X PBS to obtain a final concentration of 2 mg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... Presence of active BMP signalling pathway was detected by an antibody against the phosphorylated form of Smad1/5/9 protein complex (Cell Signalling Technology, Cat#13802S) or pSmad1/5 (Thermo Fisher Scientific, Cat#700047) as indicated in figures ...
-
bioRxiv - Microbiology 2021Quote: Plasmids expressing the crRNA with flanking repeats were ordered (GeneArt, Thermo Fisher Scientific) as pMK-RQ-0582anti#1-anti#3 ...
-
bioRxiv - Genetics 2019Quote: ... and 5 µl of protein A: protein G 1:1 Dynabeads (Thermofisher). Antibody-bond chromatin was washed four times in low salt buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Biophysics 2019Quote: ... The protein was buffer exchanged 2-3x using either 7 kDa MWCO Zeba Columns for EC1-5/EC3-5 proteins or 40 kDa MWCO Zeba Columns for full length proteins (ThermoFisher).
-
bioRxiv - Molecular Biology 2019Quote: ... STBLII cells were used for maintenance of plasmids containing tandem repeats (Invitrogen cat#10268019). Primer sequences for plasmid constructions are given in Table 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Metaphases were hybridized with telomere-repeat specific peptide nucleic acid (PNA) probes (Applied Biosystems) as described to label telomeres 89 ...
-
bioRxiv - Genomics 2021Quote: 5 μl of protein A Dynabeads (10001D, Invitrogen) were used in each MOWChIP assay ...
-
bioRxiv - Bioengineering 2022Quote: ... and BMP4 recombinant protein (Gibco; 5 ng/mL). The media was half-changed every day during the differentiation process ...
-
bioRxiv - Immunology 2024Quote: ... 5 % CO2 incubator with protein transport inhibitor (Invitrogen) added in the last 4 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 mg protein was incubated with 125 μg α-GFP antibody covalently coupled to M270 magnetic resin (ThermoFisher Scientific) for 1 h with rotation ...
-
bioRxiv - Neuroscience 2023Quote: ... After addition of protein G-coated magnetic dynabeads (5 μl beads/μg antibody, Thermo Fisher Scientific, cat. no. 13424229), the lysate+antibody+bead mixtures were incubated for 1 hour at 4°C with end-over-end mixing ...
-
bioRxiv - Plant Biology 2021Quote: ... Antibody-coated Protein A Dynabeads (Invitrogen) were incubated 12 hours at 4 °C with the samples ...
-
bioRxiv - Plant Biology 2023Quote: ... Antibody-coated Protein A Dynabeads (Invitrogen) were incubated 12 h at 4°C with the samples ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibody rabbit polyclonal antibodies against claudin-5 (Life Technologies) was diluted 1:300 in 3% normal donkey serum and incubated overnight at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: 5 μg of purified protein was mixed with 5× SYPRO orange (Thermo Fisher Scientific) in 20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from mycelia from three biological repeats using the TRIzol (Invitrogen, USA) reagent according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... and by Repeat-Primed PCR using 2X Phusion Flash High-Fidelity PCR Mastermix (Thermo Fisher). End-point PCR was achieved by amplifying across the repeat region where the presence of a single band at the expected size indicated a non-expanded Wild-Type locus ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were blocked in TBST with 5% milk protein and probed with the following antibodies: 1:2000 anti-Ty1 (Invitrogen), then 1:1500 goat anti-mouse IgG-HRP (Dako) ...
-
bioRxiv - Plant Biology 2021Quote: ... using 5 μgr Diagenode Ab C15410004 H3K9ac antibody and a mix of 25/25 μl of protein-A/G dynabeads (Invitrogen). 5-10 ng of DNA per sample were used for library preparation with Accel-NGS 2S Plus DNA Library Kit (Swift Biosciences ...
-
bioRxiv - Molecular Biology 2023Quote: ... and supernatants were incubated (2 h, 4°C) with 5 µg antibodies conjugated to 25 µL protein G dynabeads (Invitrogen). Samples were immobilised ...
-
bioRxiv - Cell Biology 2024Quote: ... A total of 5 μg of GFP antibody that was pre-mixed in a 50 uL volume of Dynabeads protein A (Invitrogen) was added to each sonicated chromatin sample with 1% Triton X-100 and incubated overnight at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... immobilized on 5 µl of Protein G Dynabeads(Invitrogen) for 10 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... alongside 5 μl PageRuler Prestained Protein Ladder (Thermo Scientific), and electrophoresed at 100-200 V for one to two hours in a Mini-PROTEAN Tetra Vertical Electrophoresis Cell (BIORAD) ...
-
bioRxiv - Microbiology 2019Quote: ... Protein was incubated with 5 × SYPRO orange (Thermo Scientific) for 10 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... using the BenchMark protein ladder (Invitrogen, 5 μL/lane) as a standard ...